GenePrediction:GLEAN_5508 Details

Name: GLEAN_5508
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:127373..125730 (- strand)
Length: 1644
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:127373..127067 (- strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_132:126985..125730 (- strand)
Length: 1256
>GLEAN_5508 class=GenePrediction position=GCSC_132:127373..125730 (- strand)
ATGTCTTCCCAACTGGACGAAAAGACCATAGATAAGCAAGTCGGATCACTTGCCACGACCGTGGTCGATGTGGGCACAGG
CGACGTCCAGAACACTCAGGTCAAGAAGAACTTCAACCTATGGAGCACGCTAGGCATATCTTTCTCGCTCACGTCGACGC
CCATCACCATAGGCACGTACCTCTCTGTCAGCATCGGCGTCGGTGGTAGCCCCGTCTTCTTCTTTGGTTACATCCTGTCT
GTCATCATGGATCTCTGCGTCTGTGCCTCGTTGGCCGAGATGGCCGCTGTCTTGCCGCACTCGTCCGGTTAGTCATCAAC
CCTGTGGTGAAGACCTTTCGTCCCCCTTTACTGTTCGATACCCCGTGTCTGACATTGTCACCTATCAGGTCAAGTCCACT
GGACAGCCGTGCTGGCGCCCAGAAAATACGCCCGGGGACTGAGCTACACCGTCGGCTGGCTGACGGCGGCCGGGTACTTT
TTTTGGACGGCAGCGACCTTTCTCATCACATCGCAGCTGATCTGGGCGCTGGTGCAGATCTGCCACAGTGCCTTTGAGAC
ACACCTGTGGCACTTTTACGTGCTGTATCTGGCCATCGGCCTTCTCAGCCTGCTAATCAACGGCCCGCTCTTCAGCTGGT
ATCCATACATGCTTAAAGGATTTGTCGTCTACATCAATGCGGGTGCGCTCTTTGTTATGGTTGCCCTGCTGGCCCGGGCA
TATCCCAAGGAGAGTGATAAGTACGTGTTTGTCGACATTGTCAACTTGACCGGCTGGTCGTCCAACGGGGTCGTCTTCTT
TCTCGGACTACTGCCCGGCCTTACAGCCGTCAACGGTTTCGACTCGGCGGCCCACATGGCCGAGGAAGTGCCCAATCCGG
AACGTGCGGTCCCGCAGGTGATGATGCTCAGTGCGCTCGCCAGCGGACTCAGCGGGCTGCCCATGATCTTGGTCTACATG
TTCTGCATCACGAATACGGCCAACCTGCTGGCACCGGTGGGCGGCCAGCCGATCGCACAGCTGATGGTCGATTCGCTCAA
CTCGCGCGCCCTGACCATCATTTGCATGATCATCTTCATCGTCACCTTTACGTGCGCCTCCTTTACGATGCTGACAACGT
GGAGCCGTGTATGGTGGTCTCTTTCGCGCGAAAACGGCACGCCCTTCCCTAGTCTTATGAGCCGTATCGAGGAGAAGAGC
CAGCTTCCGTACAACTCCATCATCTTTGCCACCGTGGCCTGTGCCCTCATTGGCGTGCTTGAGCTCGGCTCTAACCTTGC
TCTAAATGCAATCCTCGGCGGCGCTATCATCTGCATCTTTATGTCCTACGCCATTCCGATCTGCTGTTCACTGCTAGGCC
GTCGGAGCGCGTTTGCCGCCAAGCACTACTTTAACCTCGGCGCTGCCGGTACCGCCCTCAACATCATCTCCGTCACCTGG
ATCTTCTTCGTCTTTGTCTGGCTGTGTTTCCCCTCCTACATCCCGTATACCAACGCGACGATGAATTGGGCCATCGTCGT
CTTCGCTGGCATCCTGGCACTTAGCGGTATTAACTGGCTGGCCTTCTCGCGCAAGAACTTTACGGTTCCTGTCTCGTTTG
AGACGGGCAGCGAGGAGACGAGTATTGAAATCGGTGAAAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62