GenePrediction:GLEAN_5509 Details

Name: GLEAN_5509
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:118540..117031 (- strand)
Length: 1510
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:118540..118337 (- strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_132:118269..117031 (- strand)
Length: 1239
>GLEAN_5509 class=GenePrediction position=GCSC_132:118540..117031 (- strand)
ATGTATAGCTTAAAAAAGTCTGCAGGCGTGAGCCTCATTGCCACGTTTTTCATTGGCAGCGTGACTTCGAGCTCCTGCGG
GAGCGATCAGACGATCTCCCGCGATGTGGTTGTAGTCGGTGGCGGTGCGTCCGGTTCCCATGCGGCCGTGTGGCTGCGCG
ACAATGGAATGAGTGTTGTTTTGGTGGAGAAGGACAGCCTGTTGGTATGTTATTTGCGCCTTTGGTCCCTATTCCTGGCC
CGTTGTTGTTCTTGGCTAACTCTTTCCCAAGGGCGGCCACACCAAATACTATACGGATCCAGTCTCCAATGAGACGCTTA
ATATCGGTGTGCAGGCGTGGATGCAGTATGAGAGCGCCTACGACTTTCCGACCCGTATGAACGTGTCGACGAGCGGGTCA
ATGAAGTTCACGACCAACACGAATGCATTCATCGACTTCAAAACAGGTCTTCCGGTGCCCAACTATGCCGCGCCCTCGTC
CACGGACGAGTATGCGGCCCTGGGCGTGTATCTGAACCTGTTGGAGAAGTACCAAGACATGCTGCTGCCGGGATATGACA
ACTTTCCCAACGCAAGCTCCATCCCAGAGGATTTGTCCATGCCGTTCGGCGAGTTTGTTGTTAAGTACGGAATCGAGGCT
GCAGTGCCGCAGCTCTGGGACTCGACCGATCAGGGTCTGGGCGATACCATGAACGTGTCGACAATGTGGGTGATGCAGGC
GTCGACGACGCCCGAGGCCAAGGCCCTGCTAGGCACAGCTGCTGCCGCTGTTCCGGCTTCTGGCCGCCTGTGGGACTTAT
ACGAGAGCGTGCAGAACTTTTTGGGAAGCGACGTGCTGTACTCGACCTTGGTGACAGAGTCAACTCGGTCAGACACTAAC
GTCACGCTGAAGACGATCAACACGGTCACGGGAGAGGTCACGTGCATCGAGGCCAAACGCTTGCTGATGGCCATCCAGCC
TACGCCGGAGAACCTGCTACCGTTTGATATTGACGCCAGCGAAAAGGCCGTCTTCAGCCAGTTCCAGTTCTCCACCCTCT
ATGCAGGCATCCTCCGCCACCCGTCTCTGCAGGTCAACACATCTTACAACGACCGCTCTGCAGCACCTGGGTCCACCAAC
TACACTGTCTTCCCTGTCTACCCCCAGCTCGGCTTCTTGACCTACATTGGCGGCACGGAGGACTTGTTCCACTTCACAGC
CGTTGGAACTGAGGACTATGATGCAGAGCGCATGAAGGCTCTCATCGCCCAGTCTATTGACAATATGATTGTGGCTGGCA
CCATTCCCAAGACTGATGGCACCCTTACCTTCTCTTACTTTGCTGATCACGGCAAGATGCACCCTCGCCTGACCGCGGAA
GTCCTCAAGACCGGCTTGATTCAGGAGCAGCTCGCTCTCCAGGGTCACCGCTCCACGTGGTACACTGGTGGCGCCTTTGC
CGCCCCATTTTCGACCATCTTGTGGGAATTCAACAAGGAGCTCTTGCCTAACGTGATTAAGGGGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62