GenePrediction:GLEAN_5511 Details

Name: GLEAN_5511
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:112308..110453 (- strand)
Length: 1856
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:112308..111707 (- strand)
Length: 602
Type: CDS
Source: GLEAN
Position: GCSC_132:111625..110910 (- strand)
Length: 716
Type: CDS
Source: GLEAN
Position: GCSC_132:110824..110720 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_132:110667..110453 (- strand)
Length: 215
>GLEAN_5511 class=GenePrediction position=GCSC_132:112308..110453 (- strand)
ATGCCTGACGACAAAATCAGCACTCAGGCCATCGAGACTGCCCACGACAATGTCTCTAACAAAGCCAAGCATCACCCAAA
CCTCCACACCCTTGGCCGCATCCGCCTTCGCCATGAGCACACTAATGAAATAATCCTGACGCCGGCTCCATCTGCCGACC
CCAACGATCCCCTTCGGTGGTCTACCGCCTACAAGATTTACATCTCCGTTCTCGTCTCGCTTGCCATGGTCATGTGCAAT
TTCATGGCCGCCGGTCCGACCGTCGCCATGCTCGCCATTGCCTCGGACTACAAGCACGGCGGCTCTACTGTCAGCTCTTG
GGTCTCCAGTGCATCGTACTTTTTCAACAACAGCTCCCTCCTACAGGGCGTTTCCTGTCTCTTCTGGGTCCCCCTGCTGA
ACAAGTACGGCCGTCGACCGGTCTATATCGCCTCGCTCATCCTCTATCTTTCCATGACCATCGGATCCGGCTTTGCCAAG
ACCTATGCTGGCGAGCTGACCACACGAACCATCTTGGGCATAGGCGCCGGTGCCGGCGAGTGTCTTGGCCCAGTGACCAT
TACCGACGTGTTCTACCTGCACCAACGTGGCTATGGAATGGCGTAAGTGACTATTAGTGTTGAAGAAAGAAGAGGAAAAG
AGAGAGAGAAAATCACTCCAAGCAAAACAAGCTAACCTTCTAGAATCTACAATGCTGCCCTTTCGGCTGGTGTTGCCTTT
GGCATCATCATCTCTGGCCTCATCACTACTCGTGCCCCGCCCCACCCAGGGCGGGGCACGAGTATTGCCAATCCCTGGCG
CACCATCTACTGGGTCGGTGCTGCCCTTGTCGGCTTCCTTCTCCTCGTCGTCTTCTTCTTCTTCCCCGAGACCGCCTTTG
TGCGCACTGCCGACGGTGTCGATGACGATGATGGCGACAGTCGCTCTAGCCACCATTACCGCAAGCTCTCGTACGGCCAG
CAGCTGCGCCCGTGGACTGGAAAGACGTATACTGAAGAGTCCTTCTGGCGTATGTTTATCCGTCCCTTTGGCCTTATCCT
GCTGCCGCCTGTCTTCTGGGCCACCATAGTGATGTCTGTCACCATCGGCTTCCTTGTTGCTGTCGTGTCCAATTTTGCCA
GCGCCTTCAGCGCTACCTACGACTTTGAGACCTGGCAGTCCGGCCTCTGCTTCGTCTCCGCCATCGTTGGCTGCGTCTTT
GGCACCTTTGCAGGTGGTCCGTTTTCCGACTGGGTCGCCGACTACTTTACGCGTCGCAATGGCGGCATTCGTGAGCCCGA
GATGCGTCTGCCAGCTATCATCCCCAGCGTCATAGCTGCCCCCATGGCCCTCGCCCTCTATGGCGTCGGCATCGGCAACT
CTCTTCACTGGATGGTGCCCACATTCGCTCTTGGCTTACGTAAGCTTTCTCTTCCCTTTTCCCGTTTTTTCCTTTCTGTT
GTATACACCACCTCCATGTCTTTCCTTTGACACTGACAAACCAGTCTCCTTTGCGATTTCCCAGGGTACCAATGTGTCCT
TTGTTTACTGCATAGACTCGTACCGACCGGTGGCAGCCGAGGTCACCGTGGCTCAGCTAGCCTTCAAGTGTACGTGGATA
TTTTTCAGCACAATTATCCCCAGTATTCTAACCTGCCACAGCCTGCTTTGGCTTCCTCCTATCCTTCTACACAAACCCAT
GGGTAGACAAGTCCGGCTATAAGCAGGCCTATGGCGCGATGGCCGGCATTTCCGGTGGCTGTCTGCTCTTCTTCATACCC
CTCTTTTTCTGGGGGAAGCAGATCCGTCTGGCCTCTATGCAGTGGCGTATTGTCCGCTTTGTCTTCTGGAAGACCGACCG
GGAGGTGGGCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62