GenePrediction:GLEAN_5512 Details

Name: GLEAN_5512
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:109916..109281 (- strand)
Length: 636
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:109916..109667 (- strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_132:109581..109477 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_132:109405..109281 (- strand)
Length: 125
>GLEAN_5512 class=GenePrediction position=GCSC_132:109916..109281 (- strand)
ATGGCTACCACAACCTTACTGGATCTCGATGTAGACCGTCTGAGCCTGGATCGCTTGACTATCTATGCTGGCAAATGCCT
CGCCGTCTATGTTGCCATACACGTATTCCTAACCGGCAATGCGGTAGGGCCGTTGGGATTTCGGTGCAGCATCACCGGAA
CCGAGCAGCCAAACAGAATGCAGAGATTGTCGCCACTGGCCGTCTGCCGGGAGTCAATGTTCTTCAGCGCCGTCAGGTCA
CATTCAATCTGTAAGCCTTGTGTTGATACCCTGAGAGACCTTGGATCTCGAGCCTACCGTGGGGGGCACCCTTGTCTGGC
TGACTGTACTTGTAGATGATGTCCCGCAGGTCAGTCGTCTCAAAGAAGCCGAACTTGGTGACCAACGACTTGAGGCTCCA
GAGCCGTCCACCACGTCACCGTTGCATATCACGGAAAACCGTGTGTGTCGCGCTAGACATGCTGAGGCGGCGTCGATTTG
ACCCTCAAACGGCTACGCGTGCGTTTTGCAGAGATCGATGACGTGGTTGAGCCGCTGCACGAGGATTTCTACGGCGCCAG
AAATGCCAGCCAGGTTCCGTCTTCTCTCCACATTGAGCAACGAGTCCTGCAGTGTCAAGCTGAGCACATGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62