GenePrediction:GLEAN_5513 Details

Name: GLEAN_5513
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:104460..103600 (- strand)
Length: 861
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:104460..104452 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_132:104314..104276 (- strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_132:104214..103600 (- strand)
Length: 615
>GLEAN_5513 class=GenePrediction position=GCSC_132:104460..103600 (- strand)
ATGCTGGAGGTGATATGGACTACGTTGCGGCATGTATGCTTCACGCAGCTTTGTTGCCGCTTTACGAAACTGGAAGGCTA
TCAGATCTGACTGTAACTTGTGGTGGTCGGACATATCGTGTGCACAAAGCTATCGTGTGTGCGCAGTCACCATTTTTCGA
CAAGGCTTGCACTGGTGTTTTCAAGGTGAGCTTCCTGGCTTACAAGATGAATAAAATTCGAAGACTCACTCAAGCTACGG
ACACAGGAGGGGCTAGAGCATAGTGTTGACCTCCCAGATGAAGACCCCGACACCGTTGATCGATTTTTTCGATTCCTCTA
CGCCGGAAACTATTCTGATGGGGAACATTACGATGATTTGCCATCGAATACCGCCTTAATAGCTCCCGGGCCGGACTCTG
AGTCCCCCCCGGCGGAGGATACCCTCGACTATGACTCCGATGGATCAGATTACATGGAGACAGAAGATGGCATTGAGATA
GATGCAAACCTGCCTCTTCCCAGTGGGTGGAAAAATCGCGCCATCACAACCTTATATACTTCCCTCCGAGTTTACATAAT
GGCGGACAAGTACGATGTGTCAGCTCTGAAGCTGCTATCTGGAGAGCGATTTAAGCGTACCGCCGAAAGGCTATGGTGTG
AGTACGATGACTTTCCGGCCGTGGTAGATCTGCTGTATGGATCCACGATGTCAGGTGACCCTTTACGAGAGTTCGTTTGT
GCACTCATTACCCATCAATACCATGGCGATGCCGGTCTACGTGCTAGGATGAAGCCCGTATTAGAGAAAAACCCTGACTT
TGCCATCAAGCTGCTAGAAATGATGGTGGGCATCACCACGACGGACGTGGCCTTGCGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62