GenePrediction:GLEAN_5514 Details

Name: GLEAN_5514
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:100691..96720 (- strand)
Length: 3972
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:100691..100350 (- strand)
Length: 342
Type: CDS
Source: GLEAN
Position: GCSC_132:100291..99382 (- strand)
Length: 910
Type: CDS
Source: GLEAN
Position: GCSC_132:99313..99246 (- strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_132:99050..98988 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_132:98833..97038 (- strand)
Length: 1796
Type: CDS
Source: GLEAN
Position: GCSC_132:96939..96720 (- strand)
Length: 220
>GLEAN_5514 class=GenePrediction position=GCSC_132:100691..96720 (- strand)
ATGAGTACGATCACCTATGATGGGTGGGTGCCACCTACGTTTGACGAGGTTGACTTCTCGACCTTGGATTGCAAGCTGGC
CGCTGCGTGGTTCACAAGCCTTATCAGCTTGGAGTACAACGACACGCAGAGTTTTGACGCACCTATAGAAGCGACGTACA
ACTACATCACCAGCTTTGTCCCAAACATTCCAACTCTTGGCCAGGCCTTGGATTGGTACGGAAACATGAGCGATGACTCG
GACATTTATGATACAATGGTCTCGTTTCCAATATACAACTGCTCAGTCGAAGTTTGCAAGCAGCTAAACTGGTCGGGCGA
CGCTGACCTGGCTGGTATTGGTGTACGTGTCCGTGGTGCAGTTGGAGAGGCAGAAAAGGCTGACGCGGACTGTCTCACAG
ATGATGTTTGTGTATTATCTGGCAGCCGCTCTGGCGACGGCGTACTTTGTCCTTTTGGGCGCGGATCGGCTAGAGCCCTT
TAAGAAGACGGCATGTTTGCACGGCCTCTGGAGTCATTTCATAGCAGCCTTTGACAAGTCAACCGACAGCTTTCTCGACG
CAGCCCTCCTCTTCTGCATCTCGATCCAGATTGCCGGGACGTACCGCCACACGTCGGCCCGCATCCATCCGGACAAGACA
CACTCGCTGTACTGGCTGACAAACGCGACGTACATGAGCTTGTTTACCATCTTCCCGCCATTGATGCTGCAGATTGCCAG
CCGAGACCTGAAGCACAAACGGGTCCGACTTTTGTTCTGGCTCGTGGTGATTGCCTTTACGGTGACCAACATTGCCATGT
ACTACAGTCTTACCTTTAGTTCGAAGCGCCTGGACAAGCTGCTGGACCGGGCCGCTGCGGAGTCGGACACGGTATGGTTG
ATTGACTGCGAGCCAGTTGGACTGCGCGAGTCGCTCGACTATGTGATGATCGTGGTCGAGGCCCTGCTCGGCATCAACTT
TTTCGTCTGGGTCTACGCAGTCTTGGCCTGTCTGAAGAATGAGAAGGGAATGGGTGAGCAGGAAGTGCATGTGCAGACGA
TGAATGGAAAGACAGCGGTCGGCCACATTGTTGCTATCAGTACGCGTCAGACAACGTTCTGGGCCGGCAAGGCGCGGCTG
CTGAAGCTGGTCAACGGCGGCCTCTGCTGCATGGCCATGTGGGCTCTCCTGGGCCTCTTCACGCGGTACCGCGGCCGAGT
GGAGCACGAGATGGGCTCTGTCGATGATGATGCGCAGTGGAGCTTTGGGCAGGTTCTTTCGCTGGCCACATGGGCGCCGG
TGGCAATCGAACTGCTGATGGCCTGGGCAGGTGAGCGGATGCTTTTCAAGAGCGAGAAACCTGCTCGTCTGTGCTAATGA
TGATACCAGAGTATCCAGTCAGTCAGAAAGACATCACCGAGGGCAAGAACGTCCAGCAGGAGACGAAGCAGGGCGCAGAT
AGCGGGGTCTGAATTGGAGCCAGCTCGAAACGAGATTAGTGAGCAAGTAGCCGCAGCTTATCAATGGCAATCGAGGTTTT
GTTTTGTCACAGCAACATTATCGGGCGCAAGTGGATGGTCCCGAGATAAGTGCTCTGTACCGTAGGCGTCATCGTTGCAG
CCGGGCTACGGAAACCGGTCATCTCTGTGGTCTGCATAAAGCTGGGCGTCATGAAGCCGTACACCCCGATCACGGACAGT
GTTTTGTACCTGCCACATCGTGCAGTATGTGAGAGGACGTGAGAGAGCGGGACGTCAGAGTGTACAGACAAACTAACCGG
TGTAGTGCGATCAATGTCGTAGTCGCAAGGTGAGTAGGGATGGACCTGGTCATGTTCGGCTGCTCTTCCTCTGACATGCG
CCAGATCCGTTGCGACAGACAGCTGCCGTGCTGCAACTGTCGGCTGGCCAGGAAGCCGTGCGCCTTTACGGATGCCAGCT
CGCGGCCTCGACAGCCGAAAGTGCGGCCCGTACGAACAGAGTACGTTCTTCCTCTATCTCACCCTCCCTCTTCTTGTCTG
ACACGTATAGCGAAAAGGTGCCCAGCGGGATTGAAGACCGTCTAGCACGAATTGAGGAGGCGCTTGTGGCCCTGTCGAGG
TCGCAGAGATCGGTGGAGGAGTCGATGCAGATGACGACATCTGTAAAGGGCAGCATCCCGCAGGAAACAGCCCCCCCTCG
ACAGCACGGCAGCAGTGGCAGCTCGATCGAGTCGCAGGTGGCCTTTGCCTGCCATTACCTACAGGACATTATCGACAACA
ACGTGCTGGACGAGCACAAGGACGGACTCAGCAAGGCGCTCTTCTCGCTGCAGCGGCTGTCCGGCGACGGAGAAGCCGTG
TCTGGAGCATGGCTGCCGTACGCCAAACCGCTAGAAGGAAACGGGCTGCAGGGCCTGCGTCAACTGGCAATGCCGCCTCT
GGACGAGGTGCTGGGTCTGCTGCGTGAGCTGCGACGGACGCGACCGGTGACGTTTCCGATGGTGTGTGCATTTGGCAGTG
TTGACGGGCTGACAGAACACTGCCGACGACTCTATCTTCCCGTGCGCGAAGATGACGTGTCCTTTGAGGCCTTTTTGACG
GTCAACGCCGCCCTCTTTTTCCTCTTCAAGGACAAGATGGCCCTGGCTGTGCACACAGGTGACCAAGAGGCCGTGGTGCG
CTTCCTGGCACTGCGCAACAGCTGCCGTGACAACGTGGAGACAGCACTGGCACATATGCCACTGGTACTGGCTCCTCGAC
CCCAAGGCCTGCTGGCCCTCGTCTTGGGGGCCGGCTATGGCATCGAGATGTCGCGACCGGGTCTGGCCTCCAGGCTCAAC
ACGGCTGCCTGCCAGATGGCTGTCGAGCTGGGCTACCACCGAGACGAAGAAGCGGCGGATGGACAGAGCGATGGGCAGAA
TGACGGACTGAAGTTCGGACGCGTCCTCGGCCCATCAACCCCGATGCAGCCACACGATCACACCCACCATCACATCCTCT
TCTGGCTCGCCTACATGCACGACCGCGCCCTCTCGCTCCGTCTCGGCCGCGCCCCTATCCTGCACGACTACGACATCACG
GCACCTCGCACGCTGGCTCCTCTGGCAGCCGAGTTCGAGGGCCACCGCGTCAACATCGCCAGCTGGATCGTTCTCGGTGA
GGTGCAGGGCCGCATGTATCGCGACCTCTACAGCCCAGCCGCTCGACGGTCACCGCTACGGCCGCGCGTTGAGGCCGCCC
GATCCTGTGCAGACGTGCTCCTGCGCGAGGCCGACAGCGTGCATCAACGACGGGTTCGTCTGGAGCAGCGACTGCGCACG
TGGTCGGATTCGGTTCCGGATCCAAACCAGATGGCCGACATGGGCGACGTCGTCTGCGTCGGTGACGACGACCGAACTGC
CATGGAGGTCGAGGCTATGCTGCTTCGCGTCGACGAGGTCACGCTCTTGTCGTCGCTGACGATGGCGTTTCGGGCGATCC
CGCCGGGAGCCGATCGCGATGAGGAGGATGAAGAAGACGGCGAGCTGGACGACGGCGACCATGAGACCTGGAAAAGGCCG
CGGCGTCCCCAGATCGAATCCACCCTCTTCTGCGACAGCTGCGTCGCCATGGCCCGCAGGACAATGCAGATGCATCTCGA
ATACCTGCATCTCACCGACGGAAATCCCATGTTGGTGGCCATGCATATGCACTGGTGAGTTTGGGCGTCTGTTGTGAGCA
AGCTTTGACGGGGGCCTGTCTTTCTCGTTCGTTGTCTTTGTTTATTACTTCACCCCCATGCTGACTGCCTAGGACCATCT
TGCTCGTCCCGTTTGTGCCATTTGTCGTGCTCTTCTGCTACGTCATGGAGCAGCCCAACGCCGAGGATCTCTGCTACCTG
CAGCGCTGCATGGAAACGTTGCAGCCGTGGCAGAAGCTGTCCGCACACGCAGAACAGCTCTTCCGCATCTGCCGGGCCCT
GTACGAGGCCGCCCAGGCCTATGCTGCGTGCAGACGTCCGGGGGGGTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62