GenePrediction:GLEAN_5515 Details

Name: GLEAN_5515
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:96420..95285 (- strand)
Length: 1136
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:96420..95787 (- strand)
Length: 634
Type: CDS
Source: GLEAN
Position: GCSC_132:95706..95609 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_132:95560..95285 (- strand)
Length: 276
>GLEAN_5515 class=GenePrediction position=GCSC_132:96420..95285 (- strand)
ATGGAGCCGGTGGAGGACCCGTCGGTGATCCCGGTCGTGGACTTTGGTCCCTTTCTGGCGCCCGGAGCGACGGATGAGGA
CCGTAGAGGCGTGGCCATGGCCCTGCACGCAGCCTGTCGCGACGTCGGCTTCTTCTACCTGCGCAACCATGGCGTGTCGG
CCAAGCTGATCGCGCGCATGCTTGGCGGCGCCCGGGACTTTTTCGAGACCGCCACGCCGGTCGACAAAGACCGCATCGCT
CTGCGGAAGCGCAGTGAGGGTGGCGACAACGCCCGCGGATGGCTGCGCATCGAGAATGCCGAAAAGGGCTCACACGAGGC
TGTGGACTTTTACCGACCGGTGGCCGACGGCGAGGGCGTCATGGCCGTGGGCGGCAAGACGGTCTACGATACCGGCATGG
GCAAGAACCAGTGGCCCAGCCAGCCGAGCGACTTCAAGTCCGTCGCCGACGAGTACATTGGCCAGCTCGAGCCTCTCGGC
GTCGCCGTCATCCGCGCCCTCGCTCTCGGCCTCGGCGTCGACGAGGCCATCTTTGTCGAGCGCATCGACCGTGCCTTTTG
GAACCTGCGCATTCTCGCGTACGAGGGCCGCAAGGAACGGGAGACGGCGAATGCCGGCATTGGGGAGCACACAGGTGTGT
TGGGTTTGTTTACTTTATTTCTTCCTTTCTTCTTCCTTTCTTCTCTCTCCCTCCCTATCCTCACTAACTGTCAGACTTCG
GTCTCCTTACCTTCCTCCTCACCGATTCAACCAAAAAGTCCCTTCAGGTCCTCAGCAAGGACGGCAAATGGGTCTGGGCC
GATCCAATCGAGGTACGTATCTTCTGCCTTTCTCCTGTTGTCACTCCGCTGACTCTGCAGGGCTGCTACCTCTGCAATAT
CGGGGACATGCTCTCCACCTGGACCCACGGCCTCTACAAGTCCACGCTCCACCGTGTCGTCCACACGTCCAACTCCATGC
GCATCTCCATTCCCTTCTTCTTCGACCCAAACTGGGACGCGTTCATCTCGCCCGTGATCGAAGCCGCCGACAACGGTGCA
AAGCTGGCCCCGGTGGAGAGCATCCGCTATAGCGAGAAGTTTAAGCGCTCCCTAGATGTTCCGCTGTGGAGAGACCCTCT
GGAGGTGGCAGTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62