GenePrediction:GLEAN_5518 Details

Name: GLEAN_5518
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:81173..79206 (- strand)
Length: 1968
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:81173..80102 (- strand)
Length: 1072
Type: CDS
Source: GLEAN
Position: GCSC_132:80011..79406 (- strand)
Length: 606
Type: CDS
Source: GLEAN
Position: GCSC_132:79339..79206 (- strand)
Length: 134
>GLEAN_5518 class=GenePrediction position=GCSC_132:81173..79206 (- strand)
ATGGACACCGCTGGTCACGACACCATGGCCGAGGTCACATATGATGACGACGATGTGATGTTCATTCAATTTGATGACGA
AGACGACGGCCCTGTTCCCATTCAGGCCCCTCTTCCTCGTGAGATACTCGAATGGATGTACCCTGATGACAAAGCCATGG
TGGACTTACACTGTCAAATGAAGCTTTCCGACCATGCCCCCTACATTGGCCTCCGGAACGACTTCCTTCAAGAGTCTATC
GTTTATAAAGGACAGGAACCCGGCATTGCAGGGGGAACGATCTCGGTAGCGTTTGCTTATGAGGGAGAAATTGACCCGTC
AGCTGCTTTCACGCTGAGGGCCCGTGAAACCAGAATTGTGATCGAGAGCGATGACGACTCGCTCCCTGTCGACAACATAA
AGCCAGGGTCCTGGTTTCGGCGTGATCCAAAGCCTGAGGACGGAGAAGGATATGGATCAGCAGCGGAGCCACCGATGATC
ATTTACGACGATTTGGGGAATATCCTGAAGCTGCGGCAACCAGGGAAGAAAAACTATTTTGAGGCCATCACAGCTCAGCA
GACTGATGGCAAGAATGGCTTGAAAATGGGTCATTGTCCGTACGAGGTAGATGACAACAACGAGCAGGATCCATATTATC
TTGGTCCTACTGTTGGCTGGGCACCATACTTCCTTAACGACATGCCAAGTGCAGGATGCTTTACGCCAGAAAAGTGTTTG
GTGGATGTAGAAGATCAGATTCCGCTGCCTTTTGTTCGCTGTCTGTATGAGACGGACTCTCCGTTGGCTCTTCCATACCG
TGGTCAACATCACGACTTCCTCCCCATATACAGAACTCGCCTGCGCCAGGGAATGCCGAGAAAATGTTTTGGGGAGGCCA
GCAAGAGTCCTGTTCGTGGGGACATCAGCCTCTCCGAGTACGCCATTCTTACTGGGAGATACAGAGACTGGACCCGACTC
CTCATCGGCCTGGAGATGATTCGAGGCCAGCAAAACCGACGCTACTATGAGGCTGCAGCTACGGGACTTCTTACAATCAT
TCATTACTTAGGTCGTCACTTGAAAGAGCTTGGTACGTCGTGTTTTTACAATAGCCGTTGCTGCTCCTTTTGTTTCTCCT
AGTCCCAGAAGTTGACAACTGTAGGCCTATTGCCTGATTCAGAAAAGCATAACAGTGACATTCGTGTCTCTGCCGAGGAG
AAGACGGCTTTTTGGCAACGTATCCGCGAAATGCTGGAGAGCGTGTTTTGTCAACAAACGATGAGTATGGGCCATATCAT
GAACGGCCGATTCGAAATGGTACCCAGGAGAACAAGCAGTGCAGAGACACCGCTGGCAGGCCGTCCGTTCAGACAGCCCG
GAATGCTGCCCGAAAATTGGTGGATCTATGGCAGGGAAGTCGACAAGGATTGGATCGACTATTTCAGAGACCATTTCTGG
GGAGGTTCGGTTCTCGAAAATGACATGTTCGTTCCTGTTCCTGCCCATTTCTGTGGTGCTTTCCAGGCGCCACAGACAAC
TGCAGATACCGAGATGACGGACGAGGAGCCAGCTGGGGGCAGACAGGGGCAAGCAGAACAAAACACGCATGACAGCCAGG
ATCGTGAACGAATGCAGCCCTTCAACATCGTCGCACAATTCACAATGGAAAACCTGAGGGAGATCATGAACCAGATGTAT
TGGGTTCTTTACGGAATCCCAGGCGAGGCGCCAATAGTCGGATCCGAGGACTACTTTTCCAAAGATGAGTATCATTATCT
TTATCGGAGTAAGTGCCCTGTATATCACCGAGCCTCTATGAGGAGTCATTTGTTCCATCTAACAACATGTGCAGTGGCCA
TTTATTGCTGCCGAGAATTGAGGAAGGTGGATCCAGACAGAATGCCTCCGTCGCGCTACAGCAACCAAAAGATGTTGCGA
TATGCCGGCAGGAAGTACAGGCACCACATTGAAGAGTTTAGCGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62