GenePrediction:GLEAN_551 Details

Name: GLEAN_551
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:547719..549197 (+ strand)
Length: 1479
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:547719..548141 (+ strand)
Length: 423
Type: CDS
Source: GLEAN
Position: GCSC_97:548212..548365 (+ strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_97:548425..549197 (+ strand)
Length: 773
>GLEAN_551 class=GenePrediction position=GCSC_97:547719..549197 (+ strand)
ATGAGCGAAGCTTCCTGGCCGGCCATCCGGGCCACCTGCATCACCCTGCTTGTGCTGACGACTGCCGTGATGCTGGCCCG
GCTCGTCGGCGACGCCCGGCGATGGCGCGCCCGCCAGGTCCAGTCCGAGGACGGCTGGCTGGCGCTGTGCTACGGCTTCT
TCGTCGCCGTGGCGGCTCTGTACCTGCGCGTCGTCCCGGCCTATCTGCGGGTGGAGAGCGTCGAGATCGGCCGGACGGCG
CCGTATGCGACCGTGCTAGTAGACGCCCGCTTCATCCAGCAAGGCGTCTTCTCGGCCTCAGTCTGCATCTGGCTCTGCCT
CTGGTCGGCCAAGCTGTCGCTCCTGTGCGTCTGCCGGAAGCTGCTCGACAAGCTGCCGCTGTACCGGAAGCTGTGGTGGG
CGCTGGTCGGCTTCTCGACGGCGGTGCGTCTAATGGACGGTGTTGACCACATGACCACACAAACGAGAGAAGACACCCGC
TGACGGACCCCAGACCCTTGTTGGCTGCATCGTCAGCCTCTGCGTCTCGTGCGAGACCATGACCGCCTGGTTCACCGTCG
GCGGCTGCTCGACCCGGCGTGATGTCGCTCGCGCCGTCGTCAGCATGTGGTACTCGTATGCTGTCGATGTGCTGACGGAT
CTGCTGAGTGCGTTCTCTGCCGTCCTTTCAGCTCGAACCTAGACGGATTGCTCACCGCCCCCACAGTCATGGCCCTTCCC
CTCCGGCTCATCGCCGGCCTCCAGATGCCGTTCTTCCGCAAGCTCTCCATTGCCGTCCTCTTCGGCCTCGGCTGCGTCTG
CATCGTCGCCTCCACCATCCGAGTCACCCAGATCAACAATGGCGCCAACCATCCAACTCCGACCTGGCTGGCCCTCTGGG
GCACCGTCGAGGCCGCCACCGCCGTCGTCATCGTCAACTCGCCCGGGCTCTACCGCATCGCCAAGCAGTCCTCTGCGAGA
CGAAACCGCCGCCGTAGAGGTGGTGGTGGTGGTGATGGTGATGTTGGTGGTGGTAGCAGCTCTTACTACGGCCACAGCTA
TAGCTTCGGATCCAAGACACCGCGCAGCCAAACCAAGAGACTGGGCACCGGCACCGAAGATAGGGAGTGCACCAGCCTTC
AAAACCGTCCTGACTTTGGCACAGTTACCACCACCGTCACCGCTACCGTGACGGAAGACGGCGACGGTGAGAGCGATCAT
GACGGTTCCGTCGACCACATCGACCGCGACAACGACTTGCCCGACAACGTGCCGCTCAGGCCACCCCCCAGCGTCAGCAG
GCCCAGGCGAAGCCACAGCATTATCGCTGCGGTTGCGGCCGCCGCTTTATGGCTCGACGGCCCCAGAAAAAGCCAGGAAG
TCCTGGTTGACGGCGCTGATCACAGCCTGGGCATCGGCCATGGTCATAGCAGAGGCATCATCGTGACAAACACAGTGCAA
GTGTCGCATGGGCCAGAGACATCGCACTATGAGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62