GenePrediction:GLEAN_5520 Details

Name: GLEAN_5520
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:65213..64972 (- strand)
Length: 242
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:65213..65068 (- strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_132:65005..64972 (- strand)
Length: 34
>GLEAN_5520 class=GenePrediction position=GCSC_132:65213..64972 (- strand)
ATGCAGCTCTCTCTGCTCGCCATCGTCGCCGTTGTGGTGTCCACCGTCTTGGCTGGTGTCGTGATTACGCCCATCTTTGC
GGACCAAGTCGTGGAAAAGGCCTCTAACGACTGCTTTTTTGGCGTGACAACGCCGTCTGGTTGCGGGTATGTGCATTCCG
TGCGCTCCACTCGCCGTATTATCCAGTGCTCTTGCTGACTCTCTCCAGTCCCCTCCGCAAGACGAGGAAGACGGCGGCAT
AA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62