GenePrediction:GLEAN_5521 Details

Name: GLEAN_5521
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:53398..52389 (- strand)
Length: 1010
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:53398..53196 (- strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_132:53145..53133 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_132:53084..52389 (- strand)
Length: 696
>GLEAN_5521 class=GenePrediction position=GCSC_132:53398..52389 (- strand)
ATGCAGTCTGTGTTTCTCACAGCCACGCTGCTTGCTAGCATATCTCTGGCCAACCAAGTCGTCTCAGATGCACTTTATGT
GCGCAGCACCAGCAGCGGCAACGCATTGAAACACCACTCGACCCAAACGGCACCGCTGCGGTTTAGCGACGACGGCACAT
TCCAGCTGTCCATCTTCGAAGATCTGCACTTTGGCGAGATTATGTGAGATTTCTGAGACAGGGGCCGGTGCCAAGCAGAA
TGCTGACCAGCAGACGCCTGGGACTCGTGGGGTCCTAAGCAGGGAATGTCAACTCGGTGGCAGTGATCAACAAGGTGTTG
GATAAGGAGGCGCCGGACCTCGTCGTGCTCAACGGCGATCTGATCACGGGCGAGAGCACGTTTCTGGAAAATAGCACGCT
GTACGTGGACGAGATCGTGGCCCCGCTGCTAGAACGCAACCTGACGTGGGCATCAACGTATGGCAACGACGACAACGACG
TGAACATCTTGACCGCGCTGATCTACGCTCGGGAACACATGTGGCCCAACTCACGCACCACCAGCATGGTGGCCGACGCC
AGCGCGGACACGTCCAATTACTACCTGCCCGTCTACGGCTCCGACTGTGCGGCTGCCCAGAACGCGACCCTGACAGCCGA
CGAGGTGGCCGACCGCTGCATGCCGGCGCTGCTGCTCTGGTTCTTCGACTCGCGTAGCGGCAGCTACTTCCAGCAGCGGG
ACGCCCTCGGCAACAAGGTGCCGCAACTTGACTGGGTCGACCAGAGCGTCGTCGATTGGTTCCGCCACACTCAGGCCGCC
CTGCTGACCAAGTACGGCCAGCTGGGGAGGCGCTTGCACGGCAGCAGTAGCAGCAGTGCCACCGAGCTCATCCTTCCATC
GCTCGGCTTCGTCCACATCCCCACGCACGCCAGCTACCTGCTACAGACTCAGACCGGCTTCGGCGTCGACCCCCACAGGG
AGCCCGGCATCAACGACGATGACCCGCTCTCGCCCCAGGCCCAGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62