GenePrediction:GLEAN_5529 Details

Name: GLEAN_5529
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:421705..420355 (- strand)
Length: 1351
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:421705..421605 (- strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_146:421536..421352 (- strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_146:421207..420650 (- strand)
Length: 558
Type: CDS
Source: GLEAN
Position: GCSC_146:420575..420355 (- strand)
Length: 221
>GLEAN_5529 class=GenePrediction position=GCSC_146:421705..420355 (- strand)
ATGGCTGACGACGTTCTTAACAATATATCCCACCGCCGCTACAATCCCTTGACTGGCGCATGGCTGCTCGTCTCTCCCCA
CAGGACCAAACGTCCTTGGCAGTCAGTGCTCCTCATCTGTGAAGTTTTCTACGACTTGACTAGCAAATTGACAATCCAAA
CTCTTCAAGAGGCCAGCAGGAGGTCGCCATGAAGAACACACTGCCAGAGTATGACTCAAAGTGCTACCTTTGCCCAGGGA
ATACCAGAGCACAGGGGAATCCCAACCCCAATTACGACAGCACTTTTGTCTTTGTAAATGACTACAGCGCGGTGAAGGAG
GAACAAGAGGATTACAAGCCCAGACCTGAGAATAGTACGTATTACGCTCCGCTCTTCCTCCAGGACTGGTTGGCTGACAA
TAGATAAGATCTTGAGACGTTGTTGCTGCGCGCGGAACCGACGACAGGCAGATGCTACGTTCTCACTTTTTCCCCAAAGC
ATAATCTGACCCTTGCAGACATGCCCGCCGAAGCCATCGTGCCCATCGTTCTCTCTTGGTCTCAAATATATGCAAAGCAT
GTTTCACCTTCCAGTCCCATTTCCCAGGCAGCAGACAGCTTTTTAAAGGCCTCCCCATCGCTCGAGTATGCCGGCGTGTC
CCCTCCACGCACACAGCTTCGATACATGCAGATCTTCGAAAATAAGGGCAGTGCTATGGGCTGCTCCAATCCGCACCCGC
ATTGCCAAGTGTGGGCAACGTCTAGTCTGCCCCAAGAACCGGAAAAAGAACTTGTCCAGATGCGCAAATACCGTGCTGCA
AATGACGGTCGGCACCTGCTCAGCGATTACGTCCAGCTAGAGTTGGAGAAAGGTGAACGTGTTGTGTATACAAACGATGC
TTTTCTCGTCGTCTGCCCTTGGTGGGCCATATGGCCATTCGAAGTCATGATCATTGCCACAAGGCACGTCCGAGCGATTG
TCGATTTAACTACTGAGGAGCGTCTTTTGTTTGCAGATGCGATTCAGGAAGTTGCTAGACGTTACGACAATCTTTTCGAG
ACAAGCTTCCCTTATAGTAAGCTCGACCCAGTGATTGCGGGACTACGGAGTACCTTTAATAGGATGCTAGCTAAAAAAAC
ATACCGATAGGCTCTGGCATCCACCAAGCCCCGCTTGAATGTTCTGACGAAGAGGCAGAGAATAGCTGGTTCCACATGCA
TTTCTATCCTCCACTTCTTCGATCCGCCACAGTTCGCAAATTCCTTGTCGGATATGAGTTGATGGCTGAGCCACAACGGG
ATATCACCCCGGAACAGGCTGCAGCGCGCTTGAGGGATAGTGGAGGACAGCTTTACCGCCAGGCTCTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62