GenePrediction:GLEAN_552 Details

Name: GLEAN_552
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:562020..563337 (+ strand)
Length: 1318
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:562020..562050 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_97:562152..562594 (+ strand)
Length: 443
Type: CDS
Source: GLEAN
Position: GCSC_97:562658..563140 (+ strand)
Length: 483
Type: CDS
Source: GLEAN
Position: GCSC_97:563227..563337 (+ strand)
Length: 111
>GLEAN_552 class=GenePrediction position=GCSC_97:562020..563337 (+ strand)
ATGGCCGAATTCGAACGGATACGAAAGGAAAGTAAGTAATATAAAACAATTGAAGACACATCATGCACCAACAGCCAAGG
GCAAATATCTTGTCGTTGTTTCTCAATACTGACTATGTTCACTGTCCTCTAGGTTACGCTGCCTTAACGGCGGCGAATGG
AAACCACGAGGCGAGTTTTCAGCCCGTCAGCTACAAAAGTTTGATAGGTCGACTGCAACGCCTGCCAACTCGCAAGTGTC
CTGCAAAGCCCACACGGCCCAGTCTGCCCGGGAATTACAATGCGAGGGGCCCTGTGGCCTATGGCGACCTTTGGAACACT
TCAGCAAGCGCACCCGTGCCGACCAAGTATTTGTATGTGTTGCAATCTCCGAGAACGGTCAAGGAATCCAGCTCACTGAC
GATATCTCTTAAGTGGTGCTACGATTGCACCGCATGGCAACTCAGCGTGGAGCCTGGCGTGGCAGTATGCGCTCCTCCCA
ATTCAGCGGCCGAAGTCGATGAGCTGGCACTGCTTTACGCCAAGCCAGCAGAAGTGATCGTATCCAGGGAGGAGCGAGAG
GAGCGGGTCGAGCAGGTAGGTATCATTTTTAACGAACACAGCCCATCATGACCAATGAAAGTACTGACGCTTTATCAGTG
GATCCAAGACAACCCGAGCGAAGCTGGCGATTATGATGGTATCGAAATCGCGACGCAAGCATCGGTGATCGATACTGCCT
CGGAGGTGTCGGGACCTTCATTGCTCGACGACAATATCAACGATCTTGGCAATCTTCCCCAGGCTCTAAATGCGATCAAT
CTCAGTCGAATTGGACGCTACGACGAGCCTCCTACGACGACGGTATCCAATGTACTGGTTCGAAGTGGAAACGAGAACGC
TGCTGCCGAGTCTACAGATTTCGAGACCAGAAGCCAGGATTCTAATTCAAAGGCAACGATTATCGCTAACAGCGCCTTAG
AATCAAATCAGCAGACCGATTATGCCACCACCAATTCCAGAACGTCAGTCAATGATGTATCCAACCACGATCTCGCACTG
GTGGAGCTTGGGACCACGGCTGTCGTCAATGGCCCGCCTGAGCGGCAGCGATCCCCCGGCCCCAGTGGATGGGCCCGACC
CGTAAGTGATTGTTTTTTCTGGGGACAGAAACTCAAGTCTCCGGGGATACGTTCAGCCTTAGCCAAACTAATAATTCCTT
GAAACAGAACCAGCGCAAGATACCCTGGGCTCCCCCCAGATACGTTCTGAGTGGCAGTGGGGTCGATTTCTACCACTACT
ATTACCTGCAGCAAGGTGACGGTGACGAACCCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62