GenePrediction:GLEAN_5530 Details

Name: GLEAN_5530
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:419401..418323 (- strand)
Length: 1079
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:419401..419258 (- strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_146:419180..418323 (- strand)
Length: 858
>GLEAN_5530 class=GenePrediction position=GCSC_146:419401..418323 (- strand)
ATGGAGGGTTTTAAAGCGTCTATTGGCATGGTTCCCAAACCTGTGCAAGGCGCAATTGCATTTGTCGGTGTGGTTTTTTT
AGGGAGCAAGCTCTTCTCGAGCTTGGCTTTCTTCTTCAACTTGTTCATCCTTCGTGGAACCGATGTGAGACGACCAGAAA
ACGACGCAGATTGATTGATTCTCGTGTATATCATCAAGTAGCTAACTAATGCGACACCTAGCTACGGAAATATGGAGGTA
AGGGTACTTGGGCTGTTGTCACAGGTGCTTCGGATGGCCTCGGCAAGGAGTTTGCTACGCAGCTAGCTTCCAAGGGCTTC
AATATTGTCCTCATATCCCGCACCCAATCCAAACTCGATACCCTCGCAGAGCAACTGCAGAAGAAGTATGCCTCGTCTGG
TATACAGACGAAGGTTCTAGCCATGGATTTCTCCAAAAACGACGACGCAGACTACGATAAACTGGCCCGGCTTGTTAGCG
GCCTCGACATTGCTATACTGGTCAACAATGTAGGACAAAGCCACAGCATTCCCGTCCCGTTCCTTGAAACTACCAAAGAC
GAACTCCAGGATATTGTGACGATCAATTGTTTGGGCACATTGAAAACAACAAGGGTCATCGCTCCGGGAATGGTACGGCG
CAAGCGCGGGCTGATCCTAACCATGGGGTCGTTTGGAGGCTGGATGCCAACGCCCTATCTTGCCACGTACAGTGGCAGCA
AAGCCTTTCTACAACATTGGAACTCGTCGCTGGCCGCGGAGCTCAAGCCGAGTGGTGTCGACGCATACCTCGTACTGAGC
TACCTAGTCGTGTCAGCAATGAGCAAGGTCCGTCGTTCGAGTTTCCTGATTCCCAAGCCAGATGCGTTTGTGCGGTCCGC
ACTAAGGAAGATTGGCCGTGGGTCACAAGCATTTGCATTCACATACACGCCATTCTGGACGCATGCAATCATGCAATGGG
CTGTAGAGAATACTATAGGTGTGGGAAATAGTGCTGGCATCTGGTATAACTCAAAGATGCACAAGGGCATCCGCAGCAGG
GCTCTTCGGAAGGCGTCCCGCGAGGCGAAGAAGGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62