GenePrediction:GLEAN_5531 Details

Name: GLEAN_5531
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:416839..412478 (- strand)
Length: 4362
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:416839..416560 (- strand)
Length: 280
Type: CDS
Source: GLEAN
Position: GCSC_146:416436..413297 (- strand)
Length: 3140
Type: CDS
Source: GLEAN
Position: GCSC_146:413236..413057 (- strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_146:412840..412478 (- strand)
Length: 363
>GLEAN_5531 class=GenePrediction position=GCSC_146:416839..412478 (- strand)
ATGGCAGCAACTCCTGGGCGTCCGATTCCGGGTGCATTTTTCGCAACCCCCGCTAAAGCATCCAAACTTGACGCCGGACG
CTCATTCTTCGACGCGATACCTACATCGGACATCAACGGCTCCATTGCGCACAACCAACCGCCTGACCAAGATCCAATAG
ACCCCGTCACAGCTCTCCCTGCTCTTCCATCGCTCTCTCCTATTCTGAAGGCTGCTGGGTCGGTGAACAAGGTTCTACAG
CTCGACGAGAGCTACCCAGACCTTGATTCGTACTGTCGACGTAAGTCATTATCCTGCGTATGCCGCGCATTCACCCTTAT
ATCTGCAGGTTTCATTCACAGGGAGGGGGCATAAGGCAAGGGAGCTAATAGGATTATATCAACATTAGCTGGCGCATCTT
CAGAGTATGACATTCACGGCGCCGAATCGCCGCGGGCACCCTTCCACAAAGTGCAGACATTTCCTATCCCCGAACAGATC
TTCGAACGATACAACGTTTCCCAGCTTGTCACAATCATGGGACTCTTCCCAGAATTAAACCATGCTTATGCCTGCATAGA
TAGCAGTCTTTTCTTGTGGGACTTTACGCTGCCCAATCCCGAGCTGATAGGCTTCGAGGACCAGCCACACGCCATTACAG
CAGTCGGTCTTGTGCGTCCTAAACCAGGCGTTTTTGTCAATGACATCAGTCACATACTGGTAGTCGCCACAGAGGTTGAT
ATCATTCTGCTTGGTGTTGAGGCTACCAATACACCTGCCGGCTCAAAGGCAGTCTCATTATATCAGACAAAGATGTCCAT
TCACCGTGGCGGTGCCAATGTGGCTTTCATTGTGGGCACTTCGTCTGGTCGCATCTTCCTTGGTGGTCGAAACGATACCG
ACGTGCACGAAATCTACTACCAACAGGAAGAAAAATGGTTCTCTAACCGCGTGGGAAGGTGCAACCACAGCCATCCGGGC
TGGTCGTCGGTTGTCCCGGTCTTACCTGTCAACCTTGACTTTTGGTCACAAAGAAACTCGGAGTCTCTGGTACAAATGGT
CGTTGATGACTCGCGAAATTTGTTGTACACGCTCTCAAATAAATCCACCATACGCACATATCACATTGAGGGTCCGGACA
AGCTCACGAAGGTTATCGAGAAAGAAAAGAATCACTGTCTCCGAGACATCACACATATGATCAACTCGTCCCCGCTTTTG
ACAGACCGCGTTTCCATCATCGGCATCAGTCCCATTTCTGCACAAGAAGCTTCGAAGCTTCACTTGATGGCGCTGACAAG
CACCGGTTGCCGCCTTTTTCTCAGTGCGACAAGCTCGGCATCTTACATCATGAATTCATCGAACACAGCACCTCAATCCA
TGCAAGTTCAGTTTGTCAAGTTTCCTCCTAGGGATCAGTCAGCTGCGGTTGGCGCAATGTCGCGTCTCGGTGGATCTACA
GATGCTGTGGTGGACCTTCAATCTCGTGCCCTAGACCCTACAATAAAGGGTTGTCGGTTTGCACCAGGTTTTTTCTTTGA
CTTCGTCGGGGGGCAGGAGGTACGGCTATTCGTCTCGGCACCCGAAACTGGAAAGATACAGATGACTACCCCCGCCTCCG
CATTGAAATATTACGAGCACGGTAATTGGATTTCGCTAGGAAGAGCGCAAGACGCTTTGGATGTTGGCCTTGTGACAAAG
CCCTTTGCGGCAGCAAAGCAACCCTTGGGTTTTGGCAATGAGTTGGCTGTGCAGTTCGACTCTCCACCGAGCGAATTTGC
TATCATGACGAACGATGGAATTCATATCATCCGAAGACGACGTCTTGTCGACATATTCGCTACTGTTATTCGAGCTTTTG
GCAGTGACGACATGTTCGACAAAGAAATTCGAAAGTTCATCCAGTTATACGGGCGCGTCGAAACTATTTCTACTACCCTT
GCAGTCGCATGCGGTCAGGGAAGCGATCTTCGAGCAGGTACAAGCCGCGCCGTTGACCAGGCTACAGAGGATCGAGCCAA
GGCAGCCTTTGTTAACTACGGTGGCCAGCCAACCGTCTCCGAGACGGACAGCAGTACTATCACTATGGACTCAGTCAGGC
TCTCCTCTCGCCATGATGCCCTTGTGCTATACCTCACACGATTGATTCGAACTTTGTGGGGCGCCAGAGTTATCACCAGA
GACTTTTCCCCTACCGGTGTAGTTGTCAAATCCACGGTACCGACCGGCGAGCTCACAATTGTCCAAGAGAACCTTGAACG
GCTGCGCACTTTTCTGAAGGTTAATGCGGGCTCTATACAGGGATTGTCAGGACCTGCAGACCTGCGCCGCACCACGAGAC
ATGAAGAAATCGCCCTGCAGGCCGAGCATCAGGCGTTACATGCTTTGCAGAAGCTAATGGAGAGCATTTCTGAGGGTATT
TCGTTCGTTCTAATGCTCTTCGACGAGCGTGTATCCGACATTTATGTTAGAATGGACGACTCCACCCGCCAGGAACTACG
CTCATTAACGTACGAAAGTCTCTTCTCCAAGCCGGAGGGAAAGCAACTGGCCAAGTTGCTTGTGAAGGTCATTGTCAATC
GAAATATTGAGAGCGGCTCCAACGTTGAAACAGTAGCTGACGCTCTGCGTCGCCGCTGTGGTAGCTTCTGCAGTCCTGAC
GACGTTGTGGTCTTCAAAGCCCAGGAGCAGTTGCAAAGAGCTCTAGAGCAGGCCAACTCACCCAGCGTCGCACGCAATCT
CCTGAATGAGAGTCTCCACCTGTTTGAACGCGTCGCTGGGAGTTTGTCATTTCCGAATTTGCATGCCGCCGTCAAGCAAT
ACGTGCAGCTGAAGTACTACGCAGGTGCAATCCAGTTATGTCTTGTTGTGGCAAGGGAGTCAGACCGAGGCAACACAGCC
TCGGCATGGATTAGTGACGGAAAGTCAGAAAGCGATCCAAGAAAGTGTAAATGGGAGAGCCGAAAGGGTTGCTATGACCT
CATCCATACTGTGCTTGGCCAGCTTGATATTGACTCAACTGCGGAACCCGAGCTCATCGATGGTCGGCTCACACTCGCCG
CAACCAAACGAATGGAAGCGTACAGTGTTGTCAATGACTCCGACGATGAAGTCTTTCATTTCGACTTGTACGAGTGGTAT
ATTGAGCAAGGTCTAACAGATCGTCTTCTTGCAATTGATTCGCCACACATTGTCACGTTCCTCGAGCGCCTTGCCTCAGT
CGACGCCAGCCACGCAGATCTCTTGTGTCGTTTTTATACGCATCGCAGCAGATTTTTCGATGCCGCCAATGTTCAATACA
ACCTTGCTGCATCCAACTTTGACGTCAGCATCAAGGACCGCATCACGCTTCTCAGTCGAGCTAAAGCCAACGCCAGTGTA
TCCACAGCAGGCGTCAGTGGACAAAGTCAACAACAGCTCAACCATGAAGTGACAGAACTGCTCGATATCGCTCATGTCCA
AGACGACCTGCTTGAGAGATTGCTCTCAGATAGCCGTATACCTGCTGCTCGGAAAACTGAAATTGAAAAGGATCTTGATG
GGCCGGTGCTTGGCTTATCAGAGGTATGTTACAATTTTTGCCTACAGTTGTCAGGGTCAATTGTCAAACTAATATTGTCC
AAGCTGTTCAACGGATATGCCGATCAGGCAGGCTACTACGATCTCTGCCTCTTGATATTCAATGCTGCGGATTACCATAA
TCCTCGTGTCATCGCGGACACCTGGAAGCAGCTCATTAATAGCACACATGAAGACGTCGAAGAGCGGCTTGCTGCGTACG
AAGAGTTTTGTCGTGGGCATAGAGTGAGCGACAGCAGTATGAACGCGACTGGGCCACCGCCATTGCCATACGAAGCTGTT
TCCATGCAAGTTCAGACGATTGCACACCGCACGTCGTTGGGCTCGCTCATTTTCCCAATCGACGTTTTGCTAACAATTGT
GTGCGAATATGCGCTGACTAAACAGCAAGACGCTTCTATTGGTGCCAATCCTGCATGGCCTGTCTTGCTTTTTCTGCAGT
TGCGGGTATCTCATGCCATGATTGTTCGGGTTTTGGAGCGAATCCTAGATACGCAGGAGGTGCCATTCACTGGACGCCGG
AGAAAGGCGGTCGTGGAATGGATAAATACAGTCGTGGGCATCTGGTGCCACGAGCTCGAAGTTAGCGGTCTTGGGAGTGC
AAAGGGGGATGCAAGCATAGCGCGTTGGGTTGTCGACCTGATGGGTCGTGCTGAGCGCACAGTCCTCGACATTTTGACCT
CCGTGCGTGACGTCAGGCTGAAACAAGAACTAGAGGATGTTCTAAACGAGACCAGGATGCTTAGAGGCCAAGTGGACAGC
AATGTCCGTCCGGGGCCCCAAGCCACCATGAGATTCAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62