GenePrediction:GLEAN_553 Details

Name: GLEAN_553
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:566379..568160 (+ strand)
Length: 1782
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:566379..566663 (+ strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_97:566720..566822 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_97:566899..568160 (+ strand)
Length: 1262
>GLEAN_553 class=GenePrediction position=GCSC_97:566379..568160 (+ strand)
ATGTCGTTTTCACGACCAGGAGAGCCAGCCGAGCATGGACCCAGTGTCCAGTTTCGGGAGCCAGTCGTGTCCAGCACATC
TGCCGCCAGAAATGGAGCGAATTCTTCCGCAAAACCCGGTGATGGCGGCACACAGTCTAGGGATCTGACAGCGGCAGCAG
GCGTACTGCCAAGGGGAGCTGTGGAGTTGACGTCGGTTGATCAAAAATGGGGTGTCTTGTTTGACCGGAAAGGCCAGGCG
ACTAAACGGTTCATTGAGGTTATGCACAGCCTTGCCAAATTCATTGTGAGTTTTACACTTGTGTTGCTAACGGGTCAACT
ACTGACTTTCTGACTTTTCAGATTGAAAAGCATCTTCCAGAAGGCAGCATAGTCATCGTTCCAGAGAAGCTTCAGTCGTT
CTACTCCTTCTTGCGTATCAATGGAGAGTCGGGGTTTCATACTGGTAAGAATATCATCGCCTTCGCCTCATTTCTGACGG
ATAGAAAAAAAGAGGAAAAAAGGCTTGCTAACATAAAAAGTCATCTTCAGGTCCCCGAGCAGAGATTTGCACCGCAAGGT
TTCGGAGTTGTACCAGGACTTGGGCTGCTCATACCACCTGGTACAGGCGAAGCCAGCATCGCGACCACAAGTGCCTGCGC
TTACGCCAGATGGGTTTGCCAGGTGGATGACAATCAACGCGCAGGCCTTCCCAGACGAGGAGGCACGCCGGCTTAATAAG
GTTGTCTCGACGTCGCCTTTGGAGGCCAAAAGTGCGCTGGATGGTAAAATTGAACGCCTTCCCAAGCAGCTCTCACGCTA
CCTATTACCCAGAAAGCCAGACCACCAGATTAGAGATCTGTTGCTACAAGCTGTTAAGCGACACTTTGGTGACAGCTGTC
TCTCGAGACCAACTCTTGTATCGGTGCCAGGTTCGCTTGACCGCTTGTCGCCCCGCGACGAGGTTCTGGGTCGGGAGCGA
TCTCGCCGCGACAGCACTTCTCGGGGCCGTCCGACGTCAGCGTACTATGGCCGTGAGAAAGAGGATGAGGGCCAGACACG
CAGCCGAAACCAGCATTCGCCACATCGCCACGACTCCCACCGCGGCTCTTATTCGCAGAGGGACCGACAAAGTCCCAGTC
AGGTCCGTAGAAGAAGTCAGAGCAAAGCTGGCAGCCGGGTCCGAGATGTGAGCCGGAGTGGTGGTGGTGGCCGTCAGTTG
CCGCCGTCATCGAAGACGGTGGCCCAACACTCATCGTCACGACGAGCTTCGTTTGCCGGTGACTCTACCAGCCCGCCAGT
TGTCGTCCATGGCAACGCGGGTCCTTCCTCAGGTGCAGTGCGAAGCTACCGCTCGTCATACCCAGAAGTGCACCGCACTG
TGGACAGGAACAGCGACGAGGGTTCCCGCCGTCGGCCTGCATCTGTTTACGGTCCTTCTTCTCGGATTTCGGCTGGTTAT
TTGCCCGGATCGGCTTTGAATACTTCCTTGACGGATCGAGATCGCAGCACGGGCAGAGGCCGAGGAATAGAGGGGGGCCT
GTCTGGCGTACCGAATTTACGCAGCGGCAGTTCAGCGGCACTGGCAGCTGTAGGTGGTGCAAAAGAGACCGATTCGGCGA
CAAATCCTCCCAGACAGGACAGTTCTCGGCATGACCCACGCGCCAACATACGGCGCCGTATACGGCCGGAAGATTACGTC
GCAGGCAGTGACGGTGGAAGCAGACGGACGAGTGCGATAGTTAACGGAGGAGCAGGTCGTGATGTTAGCCAAACGTGGGA
CGAGTTCTTGCGAGAGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62