GenePrediction:GLEAN_5547 Details

Name: GLEAN_5547
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:263143..258089 (- strand)
Length: 5055
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:263143..262345 (- strand)
Length: 799
Type: CDS
Source: GLEAN
Position: GCSC_146:262291..260794 (- strand)
Length: 1498
Type: CDS
Source: GLEAN
Position: GCSC_146:260528..258089 (- strand)
Length: 2440
>GLEAN_5547 class=GenePrediction position=GCSC_146:263143..258089 (- strand)
ATGCAGACCCTCTTCTCAAGCGTCATCATTGCTAAGCTTCAGTGCGATGGGATCCACCCGGCCTGTGGGCGCTGTACCGG
CTACGGCTACCGATGCGTCTATTCCGTGTCGGAGAAGCGGCGGTCCAAGCTCGAGCATGTGCATGAGGAGCATCATGAAG
TGCCGACATGCAGCCGTTTGGCCGAGGCTCTGCGTCAGGTCCTTGATGACTATGAACGTCTGGCTGTGGACACCCTGGCC
AGCCTTTCGCTGTCTGATCAGGCAGCTGCTTCAGACCGGCTGGCAGGCCTGCGACTGCGCGTCAGCGAGCTTTTCCGAGC
CGAAGGCGAACCGGTCGACCCGTCATCGCCACACCAGCAGCAACAGCAGCAACAACAAATGCCGGTTGTGCCAGCACCAG
TCTCTTTCGCCCGTCCGACAGCCGTGGCCGAGCGCTATCTCGGCGAGGTCTCGGATGTGCGCTTCTTCAATCTCATCGAC
CGGGCGCTGCAGGAGAAGAACGAGGGCGGGTCGAGCTGCTCGGCCGAGGAGCCCGGCAGCGGGGCAGCCCTCGACAGCTA
CGAGCAGGACGAGCCGTCGAGTGGTGCGGCAACGGTAGCCGCCGTCCAACTGGAGCGCCTGGCCGTTGCTCTGCCACCGG
CCGACGCAGCCGAGCGCTACCTCGACGTCTACTTCTCCACCATCCATATGGCATATCCTTTCATCCCCCGTGCGCTCTTT
GTCAGGACCTACCACCGCTATCGTGCGACCGGACGCACCGCTGACGCCAACATTGACAGCACTTGGCTGGCCACATTGTG
TGAGTTGTGCTGATCAAGCCATTTGTGCTCTCTGCCGTCCTAACCAAGTCAGACGTCCTCTTCGCCATCGGCGCATACTA
TATTTCCATCTCGGGCGACACGGGTGACAAGTCTCACGAGCAGTACTACCGCCACGCCCTGATGCTGTCCGATGCCGACA
CTCCTGAGCGCTCTCTCGGCCGCGTGTCTTTGCTGCTGGCCCAGTGCTTCTACCTGCTGGCGGCCTGTCGGACCGACAAG
TGCTGGACCACCCTAGGCTTGGCCGTTCGTGTTGGCCAGAGCATCGGCCTGCATGTGGACGTGGACGTGGACGTGGACGT
GGACGTGGACACCGGCACAGAGACGGCTCCGCTGTTGCTCCGGGCCGAGTCTCGTCGTCGAGTGTGGTATTCGATCTACG
TGCTCGACCGCCTGCTGGCCCTGCAGCTTGGCCGGCCGCCGGCCATCCACGACGACGACTGCCACCTACGGCTGCCCTCG
CGTCTGGGCGACGCCAACATCGACTGGGACGGTGCTGGTGAGGACGGCCGCTGGAGTCCGGCTGCCCAAGAAAGGTCGTC
GGCGGCCAGTCTGGGCGACTACTTTGTGTGTATGATCTCGCTGTCACGGATTATTGGTCACGTGATGCGCGACCTCTACA
GTCCGCCCCGAACACGCGACAGCATCGCCGGCTGGCTGCCGAGCACGCAGGCCCTGGACGGCCAGCTGGTTGAGTGGAGG
CGTTCACTTCCGCGGGCGCTGCGCTTCGACCTCGGCCATACGTTTGAGACGAGTCAGGCGTTCCGCCGCCAGCGCAACAT
GCTGGCCATCAAGTTCCACCACCTGCGGGCGCTCATCTACCGGCCTTACCTCTGCCTGCCGCTGCTGCGCGGCCGCAAGG
ACAAGATGCCGGACGGGCATAGCCGGCGGCTACTCGACCGCCACGAACGCACGTGCATCGCCGAGGCCCAGGACACGGCC
CACCTGCTGCACAACGTGGCCGACAAGGAGAGCCTCGTGCACGACTTTCCCTGGTGGCAGATGATCTCGTGTCTGATCTG
CGCGAGCTCTATCCTCGTGGTGGCGAGCGTCTTTGCGAGGCGCGACGAGACCGACAGCGGCGCCGAGGACGAGCAGGAGC
TCACTGGCCGCGTCGACGTGGCTGCCCTGGAAGACGACGCTGAGACCTGTCTCAAGGTGTTTGAGGCGCTCGGGGCCAAC
TCGGACGGCGCCCGTATCGCTCGCGACATGATGCGCCGCCTTAGGACACGCGGCCGGCGCTGGCGAGAGTCCCATGGCCA
AGTGCAACAACAGAAGCAGCAGCAGCAGCAGCAAGACACAATTTACACTCTTCCGGCGATGGACAATGTCAGTAGTGGCC
TGCCAAGCGATCCTGGTCCGAGCTTGGACCCAATGCCTATGGAGACCGACATCTCGCTGCCAGGCCTGCCTCTCCTGGGC
CAGAACGGTGAGCATCCGTTATATGGTGAATGGCCATCTGAGATACTGGACTCGATGGCCTGGTCTGCCCAGTTCTTCTC
GGCTGTGGATGGATCCGCGCCTCAGTTTTTGTAAGATAGTGTGTATCTAATGGAATATAGTTGTAAGCGGAAATAGTAAT
AGAGGACCATGTGAACATTAGCAGTCGTCGATGACTTTAGGCAACAGCTCGTAAATGCACAGGCCATGCTAAAGCCAATG
GCCTTGAGTTGTACTCTCTAGAGACTGGCCAATCACTGGTAGCGATAGAGGGGTTCAATAATGCAGCCCAACAGTTGCCT
GCTTTCCAGACTTGGTCATCGAAACAGCAACGATACAGAACAAAATGGCTGACAGCCGTTCCAATGCGCCTTGCCGCTTT
TTTGCGTGGGGAAAGTGCCGCAGCGGTCTGTCCTGCCCCTTTTCCCACGACGGACCCCTTGTCCAGTCCTCCCCGACAGA
AAGCTGGCAGAGACGGCAGCAAGAGAAGTCCGATGTGGGGAAAAAGGCGGACACCGACATGACCAAAGACGGGGATGACA
AGGAGGATAAAGACGACTTCAAGCGCGCCATGGCCGGGGCCTCTGTCCGGTTCGAGGACGGTGGCCGTGTGGCCAAGGTG
AGTCTGCCGGAGGACTTCTCAGCCGTACAGCTGAGCAGCCTGCCATCGGAGGGGGTCTCTGCCGAGAGCGTGAGAGCGTT
CCTTGGCGGGCTCGGCTTCTCCGTAGCGGTTACGGATGTCCGGCTGCTGCCACATGGGGATGCAGCGGTGGTACGGGCAG
AGGATGCGACCTTTTCGCAGCGGGTCTGCGCCCACATGGCAGCCGGCAGTCGCTGGGGGTCGTCTGTGGTGCGGGCAGTG
CGCGTTGCAGCGCCGGTGCCCAAGGACCACACAGCAGGCCGGGTGGATTGTCGCAAGGTGCACATCTCGTGGCATAAACC
GGTGCGGACGGCGTGGCTGCGTTTCGGCAACGAGCGGACGGCGCAGCGAGTCAGCCGGGCCTTTTCGGCGGGAGTATACC
GGGTCCTGGACCAGAAAGTCGTAGCCGGGGAGCCCGAGCGGACAGTCAGCACACGTGGTGGCTACCGGACTGTTGCGGCC
GAATGGACCGTCCGGCTGAGCGACCTGCCGGCGGCTGCCGACACCAGAGATGTGATCAGCCGAGCCATCGGGAAGCCGGC
AGACCGGCCACTGAGCATCGAAGTCAGCCAGCCGACATACCAGGCTGCACCGGGCAGCCGAATCAGTAGCACGGGCGACC
AGGACGAGGACTACTGCGCTGCCATTGTGCGGTCGCTCCTCGGGCAGTCAGGCACGGTCGAGTACTGGGAGACGACGCTG
GAGTCGACAGCCAAGCGTGTCAAGGCCACGGCGCGCTTCCTAGACGAGGCAGACGCGCGTGCAGCAGCTACCCAGCTCAA
CGGGTCCCGGCTGCCCTTTCACGCCAACGGCCGGCTGACGGTCCAGCTGGTCTGCTCGGTCCGGTTCAAAGTCGGTAGCA
GCGTCTACGATGCGCTGGCACCGCGCATCTCGGCGCTCGCTGGCAGTGCCTGGAAGACGGCCCACGTGCGCTTCTTTGCG
TATCCGAGTCCACGTCTACAGCCGGCATACCGGATCCTCAAGCTCGAGGGTGAGTCTGACCGCGCCGTCGCCGTCGCCAA
GGGCGAGCTCGACCGCATCTTGGCCGGCACCGTCGCTCGCGATCGCCAGGAAAAGCCGCTTTGGGATGAGGCGATCAGCA
GCAGCAACAGCCTCTGGCTTGAGATCCAGCGGCAGGCCAGAAGCGACTCTCCTGACAGCCTCATCGTCGTCCGCAGCAAG
ACCAGGTCCCAGATGCTCCTGTTCGGGTCGCAGGCGGCCTGCGACCACGCCCAGACTCGGCTGCGGGCGCTTCTGCTCGA
CAACGAGAAGACCTCCCACACCATCCCGCTGCAGCCGAACCAATTTCTCTGGGCCTGTCGCGAGGGTCTCGCCTCGATCG
CCGACCGGATCGGCCCTGGTAAGGCCTCGCTCGACGTCGTGTCCACGCCGAAACAGATCTGCATCCAGGGCTCTCTGCAC
GACCTCTGCCAGGCCAGGGATCTGGTCTGCAGCCAGAACACCAGCCAGATGACCAGCTCAACGCTCGCCAAGGCCGCCGA
CTGCTGCGTCTGCTGGACCGAGGATGCTGCGCCTGTCCGGACCGCCTGCGGCCACGTCTACTGCCACGAGTGCTTTGACA
ACGGCTGTGCCGCTCCGGCGCCCGGTGAAGCCGAATTCACCCTGCTCTGCCACAGCCTTGCTTGTGGACGACGACTGCCA
CTTCGGGACTTGCAGGAGCACCTCTCGTCGGCCGCCTTTGAGGGCCTGCTCGCCCACTCCTTTGCCACCTTTGTCCAGCG
TCATCCAGACCAGTTGCGCTTCTGTCCGACGCCCGACTGCGGTCACATCTATCGGTTGCTGCCATCGTCGTCATCGTCGT
CATCTGAGTCCTCCCGCTCACACACCTGCGCTAACTGCTTGCAGGTCACGTGTGCTGCCTGTGCCGAACCGCATGACGGC
GCCATGACCTGCGGGGACTATCGAGACCTGCGCTCCGGCGGCCACGCTGCCTTCCAGCGCCTCAAGAAGGAACTCGGCGT
CAAGGACTGCCCGAAGTGTGGCATAGCCATCGAGAAAGTCACCGGCTGCAACCATATGATCTGCATCGCCTGTCGCACCC
ACATCTGCTGGGTCTGTCTCAGCACCTTTTCCAGCGGCGACCTCGTATACACGCACATGCAGCGCATACATGGCGGCCAT
ATCGATCTTCCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62