GenePrediction:GLEAN_554 Details

Name: GLEAN_554
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:572185..573791 (+ strand)
Length: 1607
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:572185..572299 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_97:572378..572526 (+ strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_97:572605..573626 (+ strand)
Length: 1022
Type: CDS
Source: GLEAN
Position: GCSC_97:573728..573791 (+ strand)
Length: 64
>GLEAN_554 class=GenePrediction position=GCSC_97:572185..573791 (+ strand)
ATGTCGTGGAAGAAGACGGAACGCCTGATGGACACCATCATGCATTATGCAAGCTTCCCTGCCACCGGCGTGAGCTTGCG
GCAGATGGTCCAATTCGGCGAGAGGCCGTCTGTGGGTGCGCAACGGCAGCTCCTCTTTTTTTCTTTTTCTTTTCTTTCCT
TCCTGATGCACCGTCTCTAACCCGGCACCCTAGGTACCCTCTTTCGTGCTTCCCAGTTTCTGGCCGAAGAGCTGCCTATC
CGGCTGGCACACCGCGTCGAAGAGCTCGAAAACCTCCCCGACGGTCTGGGCGACATGCCATCCGTCCGAAAGGTGCAGGA
CTGGTACGCACAATCCTTTGAGGTAAATAGAGCTGCCCCCTCCTTTCCAGCAGCCCCCACCCACATCCTTGAAGCTGCAT
GACTCACACCGTCGCCACAGGAGATCACCACGCTGCCAAGACCGGACCTGAACAGAGAAACACGCGAACGGCTGATGCGA
CCCGGACGGACGGGTGGCAAGAATGGCTTGGTCCTGTCCGAGGCGACAAAGAACCCGAGCGTCGAGGACGGCCAGTACAG
CTCGCAGTCGCCGCTGCTGACTGGCGATGCCCACCACGGCCACAGCCATGGTCACGTCACCAGCGTCTTCAAGAAACACA
CGGGCGCGCGGCGCTACTTTGCCCTCGTCGACGACACCAGCGACTGGCCGTCGGAGCTGCACCTGTACAACCAGCGATTT
GCCCAAACGCTCAACAAGATCAAGCGGCGGCACGACGGCGTCGTCACCACCATGGCCCAGGGCATCCTCGAGTACAAGCG
ACGGCGCCAGCGCATGCAGATCGACCACACCATCCAGTCCTTCCTCGACCGCTTCTACATGTCGCGCATCGGCATCCGCA
TGCTGATCGGCCAGCACATCGCCCTGACCGACCAGAGCCACCACCGCGACCCGACCTACGTCGGCATCATCTGCACCAAG
ACCAACGTGCACGACCTGGCCCAGGAGGCCATTGAGAATGCCCGCTTCGTGTGCGAGGACCACTACGGCCTGTTCGAGTC
GCCCAAGATCCAGCTCGTCTGCAACCCGAACCTCAACTTCATGTATGTGCCGGGCCACCTGTCCCACATGCTGTTCGAGA
CGCTCAAGAACTCGCTGCGCGCCGTGGTCGAGGCCCACGGCCAGGACCGCGACGAGTTTCCCGTCACCAAGGTCATCGTC
GCCGAGGGCCGCGAAGACATCACCATCAAGATCTCCGACGAGGGCGGTGGCATTCCCCGCTCGGCCATCCCGCTCGTCTG
GACCTATATGTACACCACCGTCGATCGCACGCCCAATCTAGACCCGGACTTTGATAAGAGCGACTTCAAAGCACCCATGG
CCGGCTTCGGCTACGGCCTGCCTATTTCAAGGCTGTATGCGCGCTACTTTGGCGGCGATCTGAAGCTGATCAGCATGGAA
GGGTGAGAGTTTTTTTTCCTTTTTTTTTCTCCTACTTTTCTCCTTTTCTTGAGGGACATCCAAGAAAGAGATCACGCAAA
AGGACAGACACTGATCCCATCAGCTATGGCACCGACGTCTACCTGCACCTCAACCGGCTGTCCAGTTCATCGGAGCCGCT
GCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62