GenePrediction:GLEAN_5554 Details

Name: GLEAN_5554
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:195213..194744 (- strand)
Length: 470
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:195213..195147 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_146:195085..194940 (- strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_146:194884..194744 (- strand)
Length: 141
>GLEAN_5554 class=GenePrediction position=GCSC_146:195213..194744 (- strand)
ATGTCGAGCGAAGAAGCAGTCAGCGCGGTCGCATCGGCGCCCAAATCTCTGGGCCTTCGCAGGAACGGTTCGTACAGCGC
GGATATCCACGTCTGCCCCTCGTCTCTGCCTCTAACCTATGTCTGCAGGAAAGCAATGGCATGAGCCCAAGAAGGCGTTT
CGGCCTGCGTCTGGCCTCACCTCGTTCGCTCAGCGATCCAAGGAGCGCATTGCCAGAGCAACGATGAAGGCAAAGGAGAA
GGAGTTGAAGGACGAAAAGGAGGCAGAGAGACAGGTGAGGCAGCCTCTGAAGAGTATGCCGCGTATCGCTTGTGGCTAAT
CCGAGTCAGGTGCGCATAAAAGCCATTCGCGATAAGAAGGCCGCCAAGGAGGAGAAGGAGCGGTACGAGAAGCTGGCCGA
GAAGATGCACAAGAAGCGGGTCGAGCGCCTGAAGCGCAAAGAGAAGCGCAACAAGCTTCTGCACACTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62