GenePrediction:GLEAN_5556 Details

Name: GLEAN_5556
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:191538..185129 (- strand)
Length: 6410
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:191538..191349 (- strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_146:191275..191046 (- strand)
Length: 230
Type: CDS
Source: GLEAN
Position: GCSC_146:190973..190665 (- strand)
Length: 309
Type: CDS
Source: GLEAN
Position: GCSC_146:190584..190320 (- strand)
Length: 265
Type: CDS
Source: GLEAN
Position: GCSC_146:190235..190132 (- strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_146:190053..189800 (- strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_146:189747..188242 (- strand)
Length: 1506
Type: CDS
Source: GLEAN
Position: GCSC_146:187485..187350 (- strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_146:187249..187216 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_146:187141..187068 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_146:187014..186686 (- strand)
Length: 329
Type: CDS
Source: GLEAN
Position: GCSC_146:186622..185399 (- strand)
Length: 1224
Type: CDS
Source: GLEAN
Position: GCSC_146:185348..185129 (- strand)
Length: 220
>GLEAN_5556 class=GenePrediction position=GCSC_146:191538..185129 (- strand)
ATGAGCGGCATCCCAGAACCTTTGGGCGGCGCAGGTACCGCGAGCAGACCCCCTGCTGGCAGCGATAGCATGGCCGCGAC
TCTACCAGACCCCGCCGCTCCCGGTCTCAACGACGTCACCATAAATGCTATCACGGCCGCAGACGAGCTTCCGCCTCCTG
GACAGACCTTGACTGGCAAACAAGAACACTGTTAGTTTGGATTCGGGGTCCTTGTCCCATTGTGTCTCCGACTGCTCCGG
ATCTATAGCTGAACACAATATAGACCTCAAACGTGAACTTCTTGGAGAGCAAGCTAAATGGGAGATTTCGGAGCTCAATT
CGCCTACGGCTCTGCGCCGCTTCGGTGCTCCCTTCAAGTCGGAGGTTGGCGAGGTCTCCCCTGTTGACTCCGAACTCCCC
ATCCTGCGCTATATCTTTGTCCACCATGTCCGGGAGTTTCCCTTCCTCGACAAGGCCCGCGAGAAGGAGTTCTGGCAGGA
CAAGCTGCAAGTGGTGAGTGCCCTTCTCGAAACGGGCGAGACTGGATCCCCTCAGAAGTAGCTTCCTGGCCTTCTGACCT
TGCAGTTCCTCGAATCCTTTTCTAGCAAACACATCTCGTCGTCCGAGGACCGCCTCGAAGAGAAAAAGCGGCGCAAGTTG
GCCATCAAGGCCCAAAAGCTCGTTGAGCTGATGATGGTCTCGGGCATTCGCACGTCGTCTGGCTTTGAAGAGCGCATTCG
CTTCACAGAACTCGAGATCGTCGACCGTAACGCTATAGACAGTGGTGTTTTGGGCTCTCTCCCTGAAGGCAACTTTATCA
ATGGCTGGGACGCCAACGTTGCCGGCGTGCGCATCCAGTCGATCAAACGCAATATACGGAACCACAAACATGCTGTATGC
TAGTATTTGCCTGTCCCATCTCCCGCGCAACTGCTGACGGTAACAAGCAATTCATCCTACGGATAAAAAAAAAGGGCGAG
CTTGAATACTTTATCGGCCGACGGTACGGCGAGTTTGCTCGCCTGCAGAAAGCGTTGCATACTGAGCTTCCTGGGCGCGT
GCTTCCGCAATTGCCCAAAAAGAACAAGTCGAGCAGCACGTCGTCTTACCTCCTCGGTTCCATGGTCAGCAGCAATGACT
CAGACGGTTCATCCGTCTCGTCTGTCTCGACCCAGATGACCCTTTTTTCAAGCACAGGAGGTAGCTTGGGCGAGTCGCTC
AAGAATTTGTCAATCCGAGGTGCGTGACCTTGTCGCTTCGCCAGTCTGAGCAGGCAGAAAGATTCCCCCCTTTCTTCCCA
GTGCTCTAGTTGACATTATTTAGATAAAAGGAAATCCGGGTCTTCTTTCAGATCATCACCACGGCCTTCGATGGATGCGC
CGTTGAGTCCGAGGGCACCACTGACCCCTACGAGTCCGGTGCCAGGCGTAAGTGAAAGAAACAGACGACGACACATTTCA
CGGTTAAAGGCACGTCGGTGATCAACAGCTAACGTCATGGAGTAGTCTGCCGTTCTCTGGCGGGAAACCCAGCGCATCTC
TCTGAGGGCGTATCTTCGAGCGCTCCTCGGCAACGAGCAGATTGCCCAGTCGAACGCCATTCAGGATTTCCTGACTAAGG
ACCGGATAACGCCAAGAGATGAAGATGTTGACGATATCACGCGGAGAAAGGCTGTGGACGAGATGCGTGTCGAAGAGCAA
AAGAGGTTCTACGAGATCGCTCGACGCCGAGCAGCTGACCTTGATGTCTACATGGAACAGTATGTTCTGTTCCCCGCTTT
CAGAGCAATTGCACATCCTAACGAGTTGCAGGTTCCGTCAGGATATCGTAGAGCGGAACGGCCTCACGATGCTCTTCAAA
GAGATAAAGGAAAAGAACACCATCCAGGACTTGAGTATACAGTACCAGAAGTTTGCTGAGTGGTTGCGCATCGAGGTGGC
GGCAACCATCTACCATCTGTTTCTGGCGGAAGACAACTCGCCCGAGTTGTTTGCACAGGCGAAGCGCATTCATTCGTTGA
TACCATATACGGTAATGAAGAATGTCACACGCACCGCCAACCCGGCCGCCGTACTGGTAGGAATCCTGGACATCTTTCTG
GCCCAGCCCTTTGGAGCGCGATCGCTGATGCAACGCATCTTCTCTCTAACGCTCCACGATGGCATCCGCAACTTTCAGAA
GACTATCGACGCCCTCTCGGCGAAGATCGACGACTCCGTACTTGTCGATAAGCTGAAGGCATTCGTCTATGCCGACGAGC
CGATCAAGATGGAGATCCGGGGAGAAGCGGAAGCCGATGATGTCGACCTGATCGTGGGCGTGCTACGCTCGGAGCTTATT
GAGCCATCACTCGCGCCAGAACAGATTGGACGGCTGTACAACGCTTATGTGGCGTTCACCTCGGCCATAGAGAATGTGGA
TGAGGAACTCAAGCAGGGAGCACAGTTCTTCTCGTACCTCAAGCAGCTCTTGAAGCAGTTCACTCGGCAGCGCGATAAGG
CGATGATGCTGAGTCTGATTGAAGAGCCGGTGACACTCTCTCTATTCCGCGATCTGTTCACGATATTCTACGAACCGCTC
GTCCGCGTGTACAAGTCGGCCAACGTGTACAGCAGCATCACGGACTTTGCAACGTTTATCGACGACCTGATCAAAGTGGT
GGAGAGCTGCCGAGAGCAGGAAGCGTCGGCCGATCCGAACCAGACGGTGCAAGCCTTTATCGACCTTTGCCAGCGACACG
AACACAACTTTTACAAGTTCATGCACGAGGTGCACACGCACGACAACGGACTTTTCACCCAACTCATGGAGTGGATTGAG
GGTATCCTGGAGTTTCTGCGGAAGGGTCCCGTGAACGGCACGCTCGACGTGAACGCACTCTTCAAGGGTGCAGTTGAACT
CGGGGTTCTAGATAAGGACAAGGCAATTGCCGAGATCAACAGCCTGATAGCCTGGCAGGAGGCGCGGAAAAAGTGGCATC
AAGACAAGACACGGCAGAAGATGGCAGCGGAAGGCGGCAGCACCGATGGCTTTGGCCTGGGAATAGGAGGCAACTCGACG
CTTGCAGTGCCCATTGGCTTCAGTGCAGGAGATTTCGGCCTGGACGATGCAGACCTTGCGGACATGGCGTACGATAACAG
CAATGACTCGGACGACGAGGCGGCCCAGGAGGCTGAGGACGAGCTGGGCCCAATCGATGCTGAACGGAAACAGCGGGCGA
AGCGACAAGACCGATTACGACGAAGTGCAGGAGAGCCAGCAAAACCAGCTATCGCAGAGGTTTACAAGCTCAACGAGAAC
TTCCTGGCGATGCTGCGGTATGTGTTGGCCGAGTGACGGCAGCGGCATATTCCCATTGGATAATTAGACTTTTTGCATTT
CTCGGTTTCCATATAACCATTTATTTTTGCAATTTGTTGAGTGATGCTGCGAGCGAGGTGGCAAGTCAGTGCCGTGGACA
TGTCACATGCCACCGTAAAGACGGATGAGCAGCCGAGCTTTGCTATCGACGGCCGGCTAGAAGCAGCAGCCGGTGGGATG
GTGTAATCGTGGGAAGACACAATGAAAGTCCGATTACCGTCGAGGCCAAGACTCTTGTATATACTTTGACTTTGTAGTAG
GATCCTGCCGCTTCTGCTCTCTGTTCTAGCTTTCCTTTGCGTGGTGAAGTTTGCTGACACAGCACGTCGACGCACGGACC
AACATCGCTCGGCAGGTCCTCGGCTAAGAACGAAGCTCACAGTGGGCGAGAGAGGCGCTAGCAGTCGCGGGGAGTAATAA
TGTGAAATTGGCAGAAGCAGATTGGCCGGCTACAGGCTCGCAGGCCGACCGGCTAGCACTGGGCTTTGGGGCGTTTGGGG
GTTCCGGGGAGAGCGGTTCGGAATTGTGCGGTTTCCTCTTTTTTTCGTCATTGGCTCCTCTTCTACTGGTCCTGCGGTTT
TCCCATCCTCCTCCTTCCCACGCATCATCTTTTCCCAATTGCCTCTCTCCACTCCCCTCTCTAATTCTTCTTCTTCTCCC
TCCTACCACCGCCACCCTCTCTTCCCTCGCACGCAACATCCGTCAGCTGGTAGTGCGGAGCCGCCGATTGTCGAGGAGCA
TCCCCCTCTCCCCAAAATCGCCGAGAGTCGCATCACAGCAAGACACACGAGCAGCGTGACCAGAAGCTCTAGACGAGATG
TCGTCTGCTCGAGTTTGGAAGCGGTTGGCGTCAGTCGCCCGGCCAGCGGTGCGTGACGGATCCTTGTTGTTTTTCTCGCG
TTGCCTCAACATACAGACATGCTGACTGCTGGCTCTTGTCTCGTTTCAGTCCACAAGAAACTTTTCTAGCACGCGGCCAG
CCGGTAAGCCTTTTGTCTGGGTAGAGGAGGGACTGAACGTCAGAGCACTCGACCGCTAACACTTACACTGTCTACAGCTC
GCATCATCTCAAATGGACACCTCCGGGCCAAGGAGGCATCGCCCTTCCTGAGCAACAAGTACCCGGTCATTGTACGTGGC
AGCCTCTCCATTTCCGCAGCTCTTTGCCCTGCTGACCAAGACAGGACCATGAGTACGACGCTCTCGTTGTCGGTGCCGGT
GGTTCGGGCCTGCGTGCTGCCTTCGGTCTGGCCGAGGCCGGTTTCAACACGGCCTGCATATCCAAGCTCTTTCCCACGCG
AAGCCACACAGTGGCAGCCCAGGGCGGCATCAACGCGGCACTCGGCAACATGCACGAGGACGACTGGCGCTGGCACATGT
ACGACACCGTCAAGGGTTCCGACTGGCTGGGCGACCAGGACGCCATCCACTACATGACGCGCGAGGCGCCGGCTTCTATC
ATCGAGCTGGAGAACTATGGCTGCCCCTTCTCGCGTACCGACGAGGGCAAGATGTAAGCTTGTGGCGCGAAGCCGACGGG
ACGGCAGACAGACCGTGAGCGAGGCTAACGAGACAGCTACCAACGTGCCTTTGGCGGTCAGTCGCGCAACTTCGGCAAGG
GTGGCCAGGCTTATCGGTGCTGTGCTGCCGCTGATCGGACCGGTCACGCGCTCCTGCACACGCTCTACGGCCAGTCGCTA
GCCCACAACACCAACTTCTTCATCGAGTTCTTTGCCATTGACCTGATCATGGAGGATGGCGAGTGCCGCGGCGTCCTGGC
CTACAACCAGGAGGACGGCACGCTGCACCGCTTCCTGGCCAACAGCACCGTCCTGGCCACAGGCGGATACGGACGGGCCT
ACTTCAGCTGCACATCGGCACACACCTGCACAGGTGACGGCATGGCCATGGTGGCGCGTGCCGGTCTGCCCAACCAGGAT
CTGGAATTTGTGCAGTTTCACCCGACCGGCATCTACGGCGCCGGCTGCCTGATCACCGAGGGTGCTCGTGGCGAGGGCGG
CTACCTGCTGAACAGCGAGGGCAAGCGTTTCATGGAGCGCTACGCGCCCAGGCCAAAGGATCTAGCCAGTGGTGATGTCG
TGTCGCGGTCGATCACGGTCGAGATCCGTGAGGGCCGCGGTGTCGGTCCCGAGAAGGATCATATGTACCTGCAGCTGAGC
CATCTGCCGGCCGAGGTGCTTGCCGAGCGTCTGCCCGGCATCTCCGAGACGGCCAGCATCTTCTCGGGCGTCGACGTGCG
CAAGCAGCCGATCCCCATCCTGCCGACTGTGCACTACAACATGGGCGGCATTCCGACCAACTACACCGGCCAGGTGCTGA
CCGTCGATGAGGCCGGCAAGGACAAGCCTGTTCAGGGCCTGTTTGCCTGTGGCGAGGCTGCCTGCGTGTCGGTGCACGGC
GCCAACCGTCTGGGCGCCAACTCGTTGCTGGATCTCGTCGTCTTTGGCCGTGCCGTGTCGCACACCATCCGCGACCAGTC
GACGCCGGGCCAGAAGCTCAAGCCGCTGCGTGCCGACGCCGGTGCCGACGCCATCGAGGTCCTGGACGAACTCCGCAACG
CCGACGGCCCCAAGTCGACGGCCGAAATCCGTCTGGCGATGCAGAAGACTATGCAGAAGGATGTCAGCGTGTTCCGCCAG
CAGGATTCCCTGGACGAGGGCGTCGTCAACATCAGCAAGGTCGACCAGACCTTTAAAGATGTGGGCATCAAGGACCGCAG
CATGATCTGGAACTCGGATCTTGTCGAGACCCTGGAGCTTCGGAACCTGTTGACCTGCGCGTAAGTCATCATTCCTACTT
TTGCTTCGCTTCTGCTTACTAACAAATTAGCGTGCAAACGGCTGTGTCTGCCTCTAACCGCAAGGAGTCACGTGGCGCAC
ACGCCCGCGAAGACTACCCCGACCGTGACGACAAGAACTGGATGAAGCACACGCTGAGCTTCCAGAAGAAGCCACACGGC
CCGGTAGACCTCAAGTACCGTGCTGTAATCAGCACCACGCTGGACGAGAACGAGTGCAAGCCCGTGCCTCCGTTCAAGCG
TGTTTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62