GenePrediction:GLEAN_5557 Details

Name: GLEAN_5557
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:164371..162793 (- strand)
Length: 1579
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:164371..164215 (- strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_146:164115..163611 (- strand)
Length: 505
Type: CDS
Source: GLEAN
Position: GCSC_146:163426..162793 (- strand)
Length: 634
>GLEAN_5557 class=GenePrediction position=GCSC_146:164371..162793 (- strand)
ATGACCTGGCCAGAGACCGAGGTCTTGGTGCACATCTCGGCACCCAGCAAGGCATCCGACGATGTGAGATATCACTGCTT
AGCCCAGGCGTATCTGGACTTTGGCGCCGCCAGACGTCTTGATAACATCGTTGCTCCACAGCATAAGCGTATCAACGGTA
GGTGGCAACAGACAGATGACGAGCCTGCAGCTGCACCGTCGTTTGATCATCTCACCCTATCGTTCCGGAGTGTATGGTAA
AATGTCAGCTCTCCAGCTCCGGTGCAGGCTGTAAGCCTAGGAGATACACCTGGCCTGCGAGACCAGTTTCGGCCTCGGAC
GTCCTATGTCTCGCCGAATGTTGTCATACCAGACTCCCAGCCGGATGCGTTGAAGAAGACACCCGCTTCAAGGATTAGTC
TAAACAACTCTTTCGGCAGCCTGCACGACACCTTCATATCTGACTCGCAAGATGGCAGCATACATGGGAAAGACACATCG
CCTACAGAAGAGCATAGTCCAGATCTTAGCTTGATACGAAAGGCACCAAACAAACGAAAATCAAGCCTGTCTCGGTCGTT
CACGCACCAGCTGACCTTTGCAAAACGCGTTGCAAATGCGAGGCGAGGAGCCCCCGGGACACACTATGCTTTCGAACCTC
AGAATGAGACACAGTCCTCAGGATGGGAAGACAATCCCTCGTCTGCTATTGTCGACTTTAGCAGTGCGCTTGAGCTGACC
TCCTCACTGACGGAAAATATACCCTCGTCGCTGCCAGATGAGTGTGGCCAAAATGGTTCAAGGAACGGCAGCACCCATGA
CAAGAACTGCGATACCGGGGCTGTTTCGAGGAACATCGGCCCCTCCAGGAATAAAACGATATCGAAAACCCGAAAAGATG
GGAAGCTCGCCTCCAATCGTCTCTCGTAGTTCTACTGACGCTCGCTCATGGCCCAAAAGACCCAGATTGGAGCGGATACC
GGCGACCTCTTCCCCGATAGTGTATGGCAGAGCACACAGAAGTGACGCGGACGAAACTGCTGCGAGTGCTGCCAAAGACA
CGTCTGCCCGGAAAAGCATGCAGTCTGTGCTCTTGATGTCATCCTCGCAACCCGTCAGAGAATCATACCATACAAGCCTG
CGTATTCTGCCGCCCGAGCCGGCGTTATCTTGCGCCCACCTGGATGTGGCGGCGCTTGTTACCGACGAGTTGGCTAAGCT
TGCCCACGACCTGGACTTGGCCCGTCGCTACCGGCCGTCGGAGCCGGCTGTCCGCGTCCTTCGACCCTTTGAGCGCGGCT
TCTGGAAGGTCAACACCTCGTCCTGGACGGCAAAAAGTCGGCACGAGACATGGGAATTTCTGGCAAAGTATGTCGGACAA
GGAAGCGCTGGATGGGGTGTGTGGTGCTCGCGCGACGAGGAGCCGCACGCGTGGCTGCGCCTGCACTGCTTTGCTGCCGT
TGCTGGCCACACATATCTCCTTCTGTATGCGGCGAGCAAGCAAGTTCAGGACATGGAGGTTGCCTGGCTGGACGCATTAG
GCACGCCGGTCATTGTGGTGAGCCCGAAGAAACGGCGCCGCACAGCTTCTGGGATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62