GenePrediction:GLEAN_5558 Details

Name: GLEAN_5558
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:160616..156733 (- strand)
Length: 3884
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:160616..160507 (- strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_146:160219..159660 (- strand)
Length: 560
Type: CDS
Source: GLEAN
Position: GCSC_146:159599..156733 (- strand)
Length: 2867
>GLEAN_5558 class=GenePrediction position=GCSC_146:160616..156733 (- strand)
ATGACGCCAAGCGTGCCCGCAAAGATGACGACAGGCGTGATCGAGGCCGGAATGACGATGCACGCGGCAACGCGCGCGAT
AGCCGGCGGCGGTCACGCAGCCCAGCCGATGTGAGAGGAAGCAACAGTCAAGGGTATCGTGATGAAGTGGACTCGTCTGA
CAGACGCGGTGGACAGCGCCGTTACCGAGATAGAGACCGGGGCCGAGACCGGAATAGGGTCCGTGATAGGGACCGCGGCG
ACCTAGAACGCGATTGGGACAGAGATCGAGACCGAGACCGTGATCGTGACCGAGACCGAGACCGAGATCGAGACCGTGAT
CGCGATCGCGACCGCAACTACGACGGGTGGCGACGACGCTCTCGCTCACGGTCGCTGAACCGGCGTCGAAACCGCAGCCG
GGATGACCGAGGACACAGAGAGAATGGCGCTAGTGGCAGACGCGACGGGTCCGCTGACAGACTGCAAGGCCGCCGCGAAC
GGGCAGGGGACCCGCCGTCCCGTAGTGAAGCGGGAACAGGCGTGGGTGCGGTTGGCGCGGTTGCGGCAGGCTCGGGCTCC
AGATCGACACCCGCTGCTCCTGAGAAATTGGAGGCGGACAAGAAGGCTGAGCGCCTTGCAAAGCTGGAGGCTTGGAAGAA
GAGGCACGAGCAGAAGCTCCGCATGGAGACGGACGGGGCAGGCAACAAGACGCCCACGACGGAAGAGAAGCCTTTCGGTA
GCGCCTCGCCTGTCATTGCCCCATCAGCTACACCGGAGGCGAAGCCTGAGATTACGGCTGCGGCTGCGGCTGCATACACT
GGCAAGTTCGATCCAAAGGCCATTGCTAAGAAGTCTGCTGCCCGACATCCATCCCCAGAACCGCTCCGGCCAGTTCTCAG
GCCGGCGACAGGAAATGAGAAGGTGGTACCTCCAGCGGCAGCCTCAACGGCGCCTGCTAGGCGTCTTGCGGCGACTGGTA
AGACCCAACAATGCCCTGATGCTTACGCAACCTTTCTTACTAACGGCGCCTCATTAGCCAACAAGTTATCCGCGGGTACG
CCGTTTAGCGGCTTCGGATTCGGCAAAGGTGCAGCCGACGGAGCATCGTCGAAACGAAAGCTAAATCTGGACGACGAGGA
GACGTCAAAGAGAAAGCTAGCTAAGCTCCCCGACGTGTCGCTGGAAGATGCTGACGATACCCCCTACAACAACCAAGACG
AAGAGGATGATGAGGAGGACGATGGCAGATTTGCTGGCACAGAGGAAGAGCTCGCTGCTGCGGCCCGTGCGGCACGCGCC
CGACGCGACGAGCGACTTCAACAGCAGCAGAAGCAAAGCTCGGCCATGGAGACAGACGAGCCAGAAGATTCTGAAGCGAC
TGGTGAGGCAGCAGCAGAAGGCATGGAGACGGTCGAGACCAAGGCCGACACTATGCCAGTGGAAGTGGAAATGGAAGCTG
AAACTGCAATCGATGCAGAGAAGGCACAGCCTGTCGAAGCTCAAGCGTCCCCGCCCGCGGAAGCCATGCAATTGGACGAG
CCGCCGGTCCGCAGGAGGGCGAACGGTCACGTCGAACGCAGAGTTGCACCTACGGTCGAGATCAGCATGAGTACGGATGA
CAACGTTGATCCGCTAGATGCGTTCATGGCAGACTTGAGTCATGCGCCCGACCCGTCGACGAGGCGGAAGGTGAAGAAGC
CGGCGGCAGAACCGGAGGCATACTTTAGCGACGACGACGACTACTTTTCCAAGGCGCAGAACGGCATCGACACAAAGTCG
ATTCTCGCAATGGCGACGAAGCGGAAGAAGAAGGATATCCCGACGATCGACTACAGCAAGATGGAGCTGACGCCGATCCG
CAAAAACTTCTGGGTGGAACCGCACGAGCTGAGCGAGCTGACAGAGGCGGAGGTAGCAGAGCTGCGGCTAGATCTGGACG
GAATCAAGGTGTCGGGCAAGGACGTGCCGAAGCCGGTGCAGAAATGGTCGCACTGCGGGCTGACGCGGCCGATGTTGGAG
GTGATCGAGCAGCTGGGGTACGACAAGCCGACGGCGATCCAGATGCAGGCGTTGCCGGTGATCATGTCTGGACGCGACGT
GATCGGAGTGGCGAAGACGGGGTCAGGCAAGACGATGGCGTTCCTGGTGCCGATGTTCCGGCACATTATGGACCAGGAGC
GGGTGCGAGACGACGGACCGATCGGGCTGATCCTGACGCCGACGCGCGAGTTGGCAGTGCAGATTCACCGGGACTGCAAG
CCGTTTGCGAAGAAGCTGGGGCTGCGGGCAGTGTGCGCATACGGCGGCCCGCCGATCAAGGACCAGATCGCGGAGCTGAA
GCGCGGGGCGGAGATCGTGGTAGCGACGACAGGACGGATGATCGACCTGCTGGCGGCGAACCAGGGACGGGTAGTGAGCC
TGCGGCGGACGACATACATTGTTCTGGACGAGGCGGACCGGATGTTTGACATGGGGTTCGAGCCGCAAGTAATGAAGATC
TTTGCCAACATCCGGCCCGACCGGCAGACGCTGCTGTTCTCAGCGACGATGCCACGGATCATCGACGCGTTGGTGAAGAA
GGTGCTGCATAGCCCGGTAGAAATCACGGTGGGCGGCAAAAGTGTGGTGGCGCCAGAGATCACGCAGATGGTGGAGGTGC
GGGACGAAAAGGACAAATTTCTGCGACTGCTGGAGCTGCTGGGCGAGCTGTACATGGACGACGACGACGTGCGGGCACTG
ATTTTTGTGGAGCGGCAAGAGAAGGCAGACGAGCTGCTGCGGGAGCTGTTGCGCAAGGGCTATGCGTGCATGTCGTTGCA
CGGCGGCAAGGACCAGTCGGACCGGGATTCGACCATCTCAGACTTCAAAAAGGGCGTGTGTCCGGTGCTGGTAGCAACAT
CGGTGGCGGCACGGGGGCTGGACGTGAAGCAGCTGAAGCTGGTGGTCAACTACGATGCGCCGAACCATCTGGAGGACTAC
GTGCATCGGGCAGGTCGGACAGGACGGGCCGGCAACACGGGGACGGCGGTGACGTTTGTGACGGAGGAGCAGGAGAACTG
TGCACCAGGCATTGCGAAGGCGCTGGAGCAGAGCGGCCAGCCCGTGCCGGAGCGGCTGCTAGAGATGCGCAAGGCATGGC
GAGAGAAGGTGAAAACGGGCAAGGCCAAGGACCAGTCAGGCTTTGGCGGCAAGGGCCTGGAGAAGCTGGACAAGGACCGC
GAGGCTGCACGGCTGCGCGAACGGAAGACGCACAAGGCCGAGGGTGAGGACGACGACTTTGACAAGGAGACGGCAGCCGA
GGACGAAAAGAAGGCCAAGGCCGCGTCTTCACAGGCGCAACTGGCAGCGTCGATGATTGTGTCACGTGATGCAGCCAAGG
CCGAGGGTGTCGGTGGAGGCGAAAACGACAAGGGAGCGGCCACAGGCGACGACAAGAGAGGACCAGCAGGAGCGACGGCC
GCAGCAGCCGGAGCGACGGGTGGAGCGCTGGAGAAGGCAGCCTCGGCGATCAGCGACATCAACGCACGACTGGCCCGAGC
CGGACAGCTGCGACCGGGTCAGCCGGTAGACAACAAGGGTCCGGATGCCGGAGCATTCCATGCGACGCTTGAGATCAATG
ACTTCCCGCAAAAAGGGCGCTGGGCTGTGACAAACCGCACAAACGTGGCTAAGATCCTCGACTCGACCGGCGTCTCCATC
ACCACCAAGGGCACCTTTTACGGCCCTGGCAAGGAGCCCGGTCCCGGCGCCGAGGCGAAGCTGTACCTGCTGATCGAGGG
CGATACCGAGCTGTCGGTGGGCAACGCCTTGACCGAGCTGACCCGGCTGTTGCGTGAGGGCACTGTGGCCGCTGCCGATG
CCGAGAGCCGGGCACCGGCTAGCGGACGGTACACAGTCACTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62