GenePrediction:GLEAN_5559 Details

Name: GLEAN_5559
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:155025..152868 (- strand)
Length: 2158
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:155025..153381 (- strand)
Length: 1645
Type: CDS
Source: GLEAN
Position: GCSC_146:153127..152868 (- strand)
Length: 260
>GLEAN_5559 class=GenePrediction position=GCSC_146:155025..152868 (- strand)
ATGGACGACGAAAACGCCCGCGGCCAGCGCAACTCGCCCAGCTATCCCTACCTCAACCAGTTTACCGATACCTTGATGCT
CAACGGCCAAGCGGCCCTCGACGCCGACTTGGACGCGGTCTGGAAGTCGTTTGAGCTGCAGATCCCGCAGTGCATCGGCC
CAGAAAACACGTTGGATTGCTTTCGCACCTCACACGACGACCTCTGTGCCTATCCGCCCAAATGTCCAACGACAAACCTT
CTTGGCTCCACCACCAGTGCCCCGTCCCATATGCTCTTCCACACGCGCCACTACCCTCCACACGCCGCTGGCTTGCGTCA
GATAGTCAGCCCACACGCCGCTGCTGGTCTCGACTTCTTCCAGGGCGCCCCCAGCGCTGATGCCCATTCTGTTTTCACCA
CCGCCGCCACCAGCACCCCGTTTGGCCACGCTGTATCCGGCTCGCCAGCCACGTCTGGAGGTGGCTACACTTGTTTCGAC
CAAGACGACTTTGTCGACCAGCTCTCCGCACTGTCTTCCCCTCCACACAACCCCGTCCCGGATGTTGAGTGCGACAACCA
GTCCGTTTGTGACAGTGACTGTGGTGACGGCGAGATATGCCATGAATCCATCTGCTCAGAAGATCCGTCTGCCTGCTGCG
AGGATGAGACCTGTCTGCAAAGCGTCCCCCCGGCCGCTGCTGCGGAAACTTCTCTCACGTCGGAAGACGCCATCGCTGCC
GCTGCCCTTGCCTCCTTCGTTGGCCAGGGCATACAGTTGCAGCAGCAACCGCAGCAACCGCAGCACCAGCATGCTCTCCA
ACAGCCCTTCATAGCCACCCCTGGCCCGGGGCTTGTCATGGGCCCAGGCTCGTGCATAAGTCCTCAGTTTCTGATGAACT
ACCAGCATCTCCGCGACGCCCATAACCCACTGCAGCCGACGTCTTGTAGAGCCCCCTTCTGCCCGATCGAAGATCCCAGC
TTTTACGCTGAGTGTCACATCAAGCACGTCATACCGCAAGGCCAAGCAAGCTATTTTGACAACATCGATCTCAACATGAT
GCTAGCCGGCGACAACAGTCTGGATGCCTCTCATGAATGTGGCGCCAAGTTTCCAAATGTCGAAGCCATGGTCCAGCATT
TCTGGACTGAGCACCGCGTCTACCAGTCCGACCAACTGCAACAACTGCCGGCCAATAGCATGCACAGTCACGTGCCCGAT
CTGGCATCGTCGACAGCCTCGACTGTGTCCTTGTCGTCGCAAGATACGATGCATACACCATCGTTGGCCCTGCCCGAGAG
CTCGCCGCCGCTGGATCCGAAATTCAATTTTGCCTCCATTATTCCCAAAAACGAGTACCGACCGGATTCAGAGTGCTCGT
TGCTACTGCTGCCTGGCCGGGAAGCCAAGGACACCCAGCACATGCTGCAGCGCCACGAGTGCTTCTGGTGTGACGCGATC
GGTACCAGCCCGTGTGGCCAGGTATTTGACTCGGCCAGTGACCTTCACAGGCACACCATTGAGGCCCACACCCATCAGCT
GAAGCGCGATGTCGGTGGTACCTACTCTTGCGGCTGGCTTGGATGCAACCGCCGTGACTGCGAGGATAAGGGCGGCTTTG
CACAGAAGAGCAAGATCGACCGCCACATGCAGGTGCACACTGGTAGTAAGAATATCCTAACCTTTCTCTTTGGCCTACCT
TGTACTGACAACGACCGTTCAGACAAGCCTTTCCTCTGCGGCATCTGTGGGCAGTCCTTCTCGGCCAACCAGGCGCTTGT
CCAGCACAAACTCATCCATGCTGACATCAAACCGTTGTCCTGCGAAATATGTGGGAAAACATTCCGTCAGCATAGTGCAC
TAAGTAAGCCGATATTGGCCTCTTTTTAAACCGCGTTTCCGCACTGACACGCCTGCAGCCATGCATATCAGGACACATAC
CAAGGTGCGGCCGCTGAAATGCCCATACTGCAGTAAGGAGTTCAGCGAGTCATCCAACCTGTCCAAGCACAAGCGCATCC
ACACAGGCGATGGCTTGTACATCTGCCAATTTCCCGGCTGTGGGAAGCATTTCCACCGCAAGGACCAACTACGCCGCCAC
GGCACACAGCATAGAAAGAGCCGCGCAGACATACAGTCTCCAGCAGCGCTTGTGGCCGCATTGGTAGACATAGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62