GenePrediction:GLEAN_555 Details

Name: GLEAN_555
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:573804..574262 (+ strand)
Length: 459
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:573804..574041 (+ strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_97:574165..574262 (+ strand)
Length: 98
>GLEAN_555 class=GenePrediction position=GCSC_97:573804..574262 (+ strand)
ATGAGGGACCGAAGATCCCAAGGATTGACGACGGCAGCAAAGACCGCGAACAGCACAAACAGCACGGGAAGAAGAGCCCC
TGCCTCTATCTCCTCTCCACCAAAGACGCCTCTGCAGATCCAGGCGCAGATGCGACAAAGGGACGGCCACGGCCGCGAGG
TCTCGGAGCGCCGCCAGGTCGGCGATGCCGCCAGCATGGTGAACATGCCGTCGGAGCTGTCGCACGACCGCTCCGACAGT
GAGTTATGACTCGTCGGCCGTCTCCGGGCGCTGCTCTCAACGTCAAGGAAATCGCGCCTTTCGGCGGCCGCGCACACGAC
AACAGGAACCAAACCAGGAAAAAACACCAAAGCAAACACAGAGACCATCACCAACGGCAGTCGGGGCATCGTTTTACCAA
CTCTGCTTCTCTTGTCCATCCCCCTCTCGTGGGATTACCTCGAACGAATCATCGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62