GenePrediction:GLEAN_5560 Details

Name: GLEAN_5560
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:150839..149979 (- strand)
Length: 861
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:150839..150771 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_146:150685..150572 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_146:150509..149979 (- strand)
Length: 531
>GLEAN_5560 class=GenePrediction position=GCSC_146:150839..149979 (- strand)
ATGGCGGCCGGCGCTGGAAACTCGGGCTGGACCCAGCTACGGCAACAAGTGCGATCTCTGGAGAGCCAGGTCTGTCCATG
GTGATTCCCGTTCTTGTAAACATGCATTTCACAACCGGCTCGCCATCAATGACTAACGTTCCTCTTCTTCACAGACCGAG
AGTCTCCTCCAGACATACTCGCAACTGTCGACGGCATCGTCCAGGCCGGCCAAGCCGGCAGAGCAAGAGCGGCAAACAGA
GGCAAAGCTGCAGGAGATTCTAGAAAAGGTGTGCATGGGCGCTGCCCTTTCGGTTTCCTCGTGGGCGTCTGGTCATTAAC
CTTTCTCCAGAGAGACGGCCTGATCCAGAAGCTCACCCGCCTGCTCGAGTCCGACCCAACCCTCACGTCCTCTGCCGTCA
AGCAGAACAACCTGACGCTGCTACGGGAGAAGCTGGCTGAGCACCGCAAGGACTTGGCGCGGCTGAAGGGCCAACTTGCC
GAGGCCCGCGACCGCGCGAATTTGCTGGCACATGTGCGCGACGACATCGATGCCTACCGCGCCGGCAGCAGCCGTGCAGG
AGACCGCAACGACATGGGCGAGGCCAGCGAGGCCGAGTACATGCTGGGCGAACGTGGCCGCATCGACCGCAGCCACGACA
TGGTGGACAGCGTGCTGAGCCAGGCGTACGCGGTCAATGAGAATTTTGGCATCCAGCGTGAGACACTCGCCAATATCAAC
CGGCGCATAACGCTGGCAGCCAGCCAGGTGCCCGGGATCAACACACTGATAGGTCGCATCTCGACCAAGAAGCGCCGCGA
TGGCATAATCATGGGCTCGTTTGTCGCCCTGTGCTTCGTGGTGTTCTGGTTCTTTCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62