GenePrediction:GLEAN_5563 Details

Name: GLEAN_5563
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:139083..137264 (- strand)
Length: 1820
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:139083..139033 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_146:138935..138866 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_146:138785..138281 (- strand)
Length: 505
Type: CDS
Source: GLEAN
Position: GCSC_146:137819..137264 (- strand)
Length: 556
>GLEAN_5563 class=GenePrediction position=GCSC_146:139083..137264 (- strand)
ATGTCAATTGTTCCGATCATTACATTCAAGGCTGGGCTCTGTGAAGTGGATGTAAGTTGCCCTTGTCCCCTCGCATGCTT
CTAGACCTCTATGAAAAACTGCAGTGACGGCAAAAGAAGACTGGAGCATTGACAATTTGTCAACCTAGACGTCCACCCGA
CCTCAGAAGGTCAAGGCTCTTGTCGAACCTGGCTACATTTATCTTTACTCCGAAGAAGGTACGAAATGCGACTTGTCTCC
CGACTCTTGATGCCGCCACTGCTGAAGTGGGAGTCTCGTGTTTTAACATCCGACGTAGATCTCATTCGGTTTTGCTGGCG
GCCTCGGAATGTGCCAATTGATGTTCCGACACTGAATCTTGTCATGGTGCCAACCGACGGCCACTTTGTCCCCTACGATG
GTGCGGCCTCTGGCCACGCTTCAGCCAAGACGAACGGTCGCATTTTTGTCCTCAAGTTTGAATCGTCCTCTCAACGATAC
CTCTTTTGGCTGCAGTCAAAGCCACAGGCTGCGAGTGGCGACCCTTCCTGGATGAGCCCCCGGGACCGAAAGATTGGAGA
CATCGTCGACCGGCTGCTGCAGGGTGAGGAGCTTGACGTGAACCACGAGTTGGCTCAGGTGAAGAACAACACAGACGACA
GCCGGAGAGACGGCGATGATGATGATGAGACCATGGAGGACGTCGAGGGTCACGGCGGCTCGAATTTGCCCCAATCTAGC
AGCGGCGGCCCAGGTGCTACGGGTGGCGATGCCCGGAGCGAGGGAGAGGATTCACGTGAAGGCGGAGCTGACGGAGCGAG
AGCGTAGGTGTTCGATCTCCCCTTTAGATGTCGTTGAAAAGACAATGCGAAAAAGCATGAAGAGAAAGAAGACAAGAAGG
CCCCCCAAACCCGAAACTCCCTGAACCAAAAGTCAGATCAAAAACAGTATGCACATTCATCACGTTTATTTAGCCAAGGG
AGTTTGGCAACAGACGGTGTTTCATTGAGCATCTTAGATTTTTTTTTATCTTTTTCGAAACATTACAAGGACAGTTCATT
GGACTGAGTCTTTTTGGAACCCCTCCCCCCTTCCGGAAATAGGAGTAGGAACAGGGGATAGGAAAGCTGTGCCACCAAAG
AACAGACTTGGCCACGGAACTGCTCATCCATGTACATTAGACAAAAGGGTTTCTGTCTTCGCCTTCATATGCAGAAAGAT
GCTACCTTCATCATTGCTTTCAAATTTGAATCGACAAGGCTTTCGCTAACTCTTGTCTTTGCAGTGCTTCATCGGCAGCC
CCTGCGGATGCTGCAGCTATGGTACGCAACCTACTTGCCTCTCTATCTGGCCAGCAAGGTATTCCGAGCCAAGAGCGGCG
AGAGAAGCTCTACCCGTTGCTGAATGATCTTCTCGAACCGTCTGTGACGATCCCCATGATTAAGAGTGCGAGTGAAGAGT
ATATTGACGGTCTGCTGAGCTTCCTGCCGCCAACGGTACTCATTCTTAGCCAGCAAGATGCAATCGAGGATGGCGACATT
GTCGAGCCGACAGCAGAAGCAGCGGCCGCTGCAAAAGTAGCTATGAGTATCGCGGAGAAAAAGGGTCTTTTGGAAAAAGT
GCTACGCACTCCGCAGTTTCATCAGAGCCTGGCGAGTCTGACCATGGCTATCCGTGATGGAGGTCTACCCAGCATAGCTG
ATGCTCTCGCCATTCCCGTCAAGAACCACGGATTTCTGCCCGGTGGTGCCATGCCCTTAGGCGGCGGCGAGGCTGTAGAG
GCATTTGTTGAAGGTGTCAAATCTACAGTTCAGGAGAAGCTAGAGAAACAAAAGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62