GenePrediction:GLEAN_5564 Details

Name: GLEAN_5564
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:136781..135221 (- strand)
Length: 1561
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:136781..136464 (- strand)
Length: 318
Type: CDS
Source: GLEAN
Position: GCSC_146:136213..135221 (- strand)
Length: 993
>GLEAN_5564 class=GenePrediction position=GCSC_146:136781..135221 (- strand)
ATGGAAGAAGATACGATGGCCGAAGTGTGGTCATTTCCCACCGACGTTTCCAAGTTTAATGAGGACGAGCGCATCTCCTT
TTCGAAGCTCGACGGCAAATACATTGCAGTTCAAGAAGACGGGAACGAATTCGAGTTTGATCAGGCGCTGAAGAGATGGA
TTCCGCACGCGGATGACGACGAGAACGACATGGCCGTGGCCGCACAACTGGCCGCGTACGGCGATAGAGATACAATGGAG
GATGGCCGCGATCCTAAAAAGAATGGCGTTGCGAGGCAGGGTCAGAAGCGAAAGCAAGACCAAGCGTACGGCCACGAGGT
AAGCTGCACTCGACGTTTACCTGCAGTTGTCTCTCCATCACCAGCACTGCCCTGTTTCTTACTCAGCCCACCCTTCTCTG
TCCGAGGCATCCGTCTGGATGAAACCAACTGTGCTTTTGATTTTTTCTTTCCTTTATGTCCTTTCTTTCTTACGAAGAAA
AGAACCGGGAGCTCGTGACAAACTGACCCATACTCCACCTCTCCTCACCTCTTGGTGCCTCTTCCTCTGTTCTTCTCTCC
AAATTTAGCCATCAGACACAAGTGGAAAGCGACGAAATGACGCAAGCAGCAGCGGCGGCGCCCTGGGCATCAGTAAGAGG
GCTCGGGCAGCACAGACGGCCCCAAAGCCGAGGCAGAACACGGCTGTCTACGTCACGGGCCTCCCATCAGACGCGACGGT
CGACGAGGTGGCAGAGCTATTCTCACGCAAATGCGGGGTGATCGCAGAGGAGATCGACTCGGGACGTCCGCGCATAAAGC
TATACACAGACGCCGACGGCCAGTTCAAGGGAGACGCGCTCGTTGTCTTTTTCAAGCCGCAGAGTGTGGACATGGCCATC
ATGCTACTGGACGACACAGAGTTCCGGTTCTCGCCGACTGCAGCAGACGCCCCGCGCATGCGCGTGCAGGCAGCTGACGC
AAGCTACAAGAAGACAAGTTACGGCGAGGCAGGCGCCCCGGGGGGCAATTCGTGCTCTGGACTGGCAGCTGCAGGAACAG
CAAGTGGCGGGCAACGGACCTCGACTGCGGGAGAGGGTCAAACAAAAGCAGGAGCAAGAGGCAACCAGGACAAGCAGAAG
ATCATCAAGAAGACGCAAAAGCTTGATGCCAAGCTGGCAGACTGGAGCAGTGACGAAGAGCGGCCTTTCGGAGATGGTGG
CGGTGGCGGTGGCAGCGGCGGCATCCGCAGTTCTAAGTGGGACAAAGTAGTGGTGCTGAAGCACATGTTTACTCTGGAAG
AGCTTGAAGAGGATGCGGCAGCTCTGCTGGACATCAAGGAAGACATCCGGGAGGAATGTGCCAAGCTGGGCGAGGTGACC
AATGTGGTGCTATTCGACCAGGAGGCAGCAGGCGTGGTTAGCGTAAAGTTCCGGACAACGGCGGCAGCAGCAGCATGCGT
GCGGCTGATGGATGGGCGAGCGTTTGCCGGTCAAGTGGTCGAGGCGAGCATTGCAACAGGACGGGAAAAGTACAAGAAAG
CAAAGAGTGGCGATGGGGAGGACGAATCCGAAGAGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62