GenePrediction:GLEAN_5565 Details

Name: GLEAN_5565
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:131875..129065 (- strand)
Length: 2811
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:131875..129065 (- strand)
Length: 2811
>GLEAN_5565 class=GenePrediction position=GCSC_146:131875..129065 (- strand)
ATGGGACTTCTGCCCACGGGCCTACTTCGGCCACGGGACGCCCGCCAGCGGCTGCCCATATACGAGCAGCCGAGTCCGAC
GACACTAACTAAGGAGCGGTACTCAGACTCGGAAGCCTCGTCCGACGACGACGACGATGACGATGACGACGACGAGGTTG
AGGAGGGCGACAGCATCTACGCGGCCTCCGTGGCATCAGCTCGTGCGACCAGCGGTCCGAGCTCTCGCCAATCCTCGGGA
TCTGCAACGGCAAGCTCGCTGATGTTGCCTAAACGGCCTGCTACAGCCTCCAGCAAACTTTCTCGTCTGCCACGGCACCG
GCGGCGGTTGGGTGGTATCGGGGCTCGGCTGTATCGCCTACCAAACAAGGTGACCCGTTATCTCTGTGCGGCCATGATCT
TCACCATTCTTCTCTTCATCTTCAGTCTCGTCCGCGCCAGCCAGCTGGAGAACCGTCGGATCTCCAGCGGCCAGTTCGAC
CGTCCGGCTGCTCCGCCTCCCGCCTGGGAGTCATTTGACTTTTTGACCCGCTACTACGGCGGCGTGCGCAACCTGGTCGC
CTTAAAGGATAATGTGCCGCAGTACCCGCGCGCTGAAGATGAGCAGCCCTACAACGTCACCGCCACTCCTGGCGATGCGA
CGGCCGAAGACGTGCCTACACCGCCCAGGGTTCACCTGCACGCTGCTTCTGGCTTTGCTGTCAACAACAACAAGGGTCCG
CTGCCACCAAGCTTCCCGTTCGACCAGCACAAGAGCTCTGTCCTGGCCGACGGGGCCGCAGCGGCCGGCGGTGGTGATGC
TCCTCCGGTGGCTTGCTTCATCGATAGCCAGAAAACCGTCCGCGTCCCGTCTCTGCGCTACTTTGAAGGCCGTCCCAACG
GCTTCCCCCGCAACATCCTCGGCTCGTACGAACTGTTGTCGCTACCCGAAGATATCTGCTTCGAGCGCTACGGACGATTT
GGACCCTACGGCTACGGCTACTCTGTCCGCTCGGGCGGTCTCGGCACCGGCGAGTACGGCGAGAAGGCTGGTTCCGACGC
CATCTGGGAGTCGACCAAGCGCATTGACTACTCCACTGTCGACTGGGCTGATGTCCAGAGGCGTTGTTACAATGCCAATG
CCCACCGGTTTCGGTCCACATCCGCGCGAGCTCCACCACCCAACGGTTTCTATATCGGTGACGACGCTGCAGGTGTCCAC
ATTGTTGCGCGTGACGAAGCCAGAGGGAACAGTGCTGCTCCTGCTGCTCCTGCTGCTCCTACTGTTCCTGCTGTTCCTGC
TGTTCCTGCTGTTCCTGCTCCTGCGGCTCCTGTCAGTCCGGCCGTCCCGGCTGCCCCGGCTCCTGCTTCTGCCGATAAGG
GCCCCGCGGCAGTACACCCTCCCAGCAATGCACCGCGTACTGCTGTTGTCGTTCGGTGTTGGGATGAATTCGTGTGGCGC
GAGGATGACATCATGAACCTGCGGGCACTGATTTCGGAACTCTCGCTGGCATCAGGCTCGCGCTATGACGTCCATCTTCT
GGTCCAGGTTAAGGACGACGCCAAGAACCCCATCTGGGCTGACGACGAGATTTACCAGCAGCGGATCGTGGACACCGTGC
CGGCCGAATTCCGCGGGATTGTCACGCTGTGGACCGAGACGCAAATGCTGGCACTGTACCAGGGTATCCACGACCACTTC
ACCCGGGGCCCGGATCTGCCCGTACACGGTGTGTACCGCGGCCTGCAGATGGCGATGCAGCACTTTGCGCAGCTCCACCC
CGAGTACGAGTATTTCTGGCAGTGGGAGATGGATATCCGGTACACAGGCCACAACTTGGATCTTTTCACCAAGATGGAGA
AGTGGGCTGCCAAGCAGCCGCGCAAGGGCCTGTGGGAGCGAAACGCCCGTTTCTACATGCCGGATGTGCATGGCAGCTGG
GACGACTTCCGCCAGATGGCGCGCGTGCAGACCGAGGTCGCTGCGGCCGGCGCGGGCAAGGCGTGGAACCCTGCTCTGGG
CAAGGACAAGGACGCAAAGGACAGCGACAAGACGGTATGGGGTCCCGTGCGGCCAGCCGACCCGAACGACTGGTTTGAGG
CGGCCGCCGACCCGGTGCCGCCGACAACATACGAGAAGGACCGCTACGTATGGGGCGTGGATGAGGAGGCGGATCTGATC
ACGCTGAACCCGCTCTTCGACCCGGCAGGCACAACCTGGCTACTGGCCGACGATATTACAGGCTACAACGAGACAACTCA
AGGCGGTAAACCGCCGCGCCGCGCTCAGATCATCACGGCTTCTCGCATGTCGCGTCGGCTCCTGCGCACAATGCACCGCG
AGACCGCCTTTATGAAGCACCACGCCTTTTCGGAGATGTGGCCGGCAACGGCGGCACTGCAGCACGGCTACAAGGCCGTG
TATGTGCCGCACCCCGTGTATGTGGATCGCGAATGGCCTACGGAGTACATGGCTCATACCTTCAACGGCGGCCTGAACGG
CGCCTCTGGCGGCTCGCGCACTTCGGTCTTCGGCCAGCGCGAGCACAACTTCCTTGGCCTGACCTGGTATTACAACGCTG
GCTTCTCGCGCAACCTGTATCGCCGCTGGCTCGGCCTCAAGGTCAACAACGATGGCGGGCAGGCGTTTGAAGAGGAGACC
GACGCCAACCTGAACGACACGACGGTGGATACGATGCGCGGCGGCGAGGGCCGCATGTGCTTGCCGCCCATGCTACTGCA
CCCCATCAAGGAGGTGGAACTGCCGGTTGAGAGCAATGTGGGCGACGAGTACAACAAGAAGCCGTCCACGGAGACGGACC
CATCGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62