GenePrediction:GLEAN_5566 Details

Name: GLEAN_5566
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:126188..125417 (- strand)
Length: 772
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:126188..126041 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_146:125967..125723 (- strand)
Length: 245
Type: CDS
Source: GLEAN
Position: GCSC_146:125658..125593 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_146:125506..125417 (- strand)
Length: 90
>GLEAN_5566 class=GenePrediction position=GCSC_146:126188..125417 (- strand)
ATGGGTCTGAGCATCAGCAAGCTGTTCAGCGCTTTCCTGGGCAAGAAGGAAATGCGCATCCTGATGGTTGGTCTTGACGC
TGCTGGAAAGACTACTATTTTGTACAAGTTGAAGCTGGGCGAAATTGTCACCACCATTCCTACCATTGGTATGCTGCCAT
GCGCAGACTTTCTTCGCGTCTCCACAATCGCTGTGCACCCACTAACCGATTGCCTATTTAGGTTTCAACGTCGAGACTGT
GGAGTACAAGAACATCCAGTTTACCGTGTGGGATGTCGGTGGTCAGGACAAGATCCGGCCCCTGTGGAGACATTACTTCC
AAAACACCCAGGGCATCATCTTCGTCGTTGATTCCAACGATCGTGATCGTATCGGCGAGGCTCGCGAGGAGCTGCAGCGT
ATGCTGAACGAGGATGAGCTCCGCGACGCCATCCTCCTGGTCTTCGCGAACAAGCAGGATCTGCCTGTATGTGCCCTGTC
CACCTTTACCTAGATCCAATTCGACTCCGTGCTGACCTAATCCCTACCAGAACGCCATGAACGCCGCTGAGATTACAGAC
AAGCTGGGTCTGCACAGCCTGCGGTCACGCGGATGGGTAAGTTGACCCACCCAATCGACATAAAACCACAGATGCCTCCC
GGGAGACTACCATGCTGACTGACGGCTCTTTTCCCTGAATAGTACATCCAGTCGACATGCGCCACCTCTGGTGACGGTCT
GTACGAGGGTCTCGACTGGCTCGCCACCACTCTGCGGAAGACGAACAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62