GenePrediction:GLEAN_5567 Details

Name: GLEAN_5567
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:121564..120273 (- strand)
Length: 1292
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:121564..121525 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_146:121407..121368 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_146:121101..120722 (- strand)
Length: 380
Type: CDS
Source: GLEAN
Position: GCSC_146:120637..120429 (- strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_146:120353..120273 (- strand)
Length: 81
>GLEAN_5567 class=GenePrediction position=GCSC_146:121564..120273 (- strand)
ATGGGTTTTCCCGATGTTACCACTGACGCCGGTGTTGCTGGTATGTTCCATACCGTCTTTTTTTCTGAAGACGAACAAGT
AGCTTGCCGTCTGAAGGGCTTCACCTTCGTCTGGGCAACAGCGCAAGATGAGCAGTCAATCTGACCAATGCGTGCAGTGC
TCAACAGCTGGCTGGCCACTCGCTCGTACATTTCTGGGTACGTTTTTTCCTTTTTGTCTAGATTTAGCTGCGTTTCTTGA
AGCCCTGTCAATTTCCTGTCAGCACATTGGTTCAAGATACATTTCCGTGATGAGAACATATTGGTCCGTGTTTCTGAGTA
GACTCAAGACCTACACATGACGACCCCAATAGCAACACAGTTGCACCTCTGATCTTCTTGATACCAATTTCATATACGAC
CTTCAAATTTGGCGCTCGCGATTCGTTTTAATGGCTAACCGGGTCTTTGCTTTGAAAATATAGCTATGCCACTAGCCAGG
CTGACGTCGCCGTTTTCAAGGCACTGAAGTCCTCTCCAGAGACAGCCAAATACCCGCACGCTGCGCGGTGGTACAAGCAT
ATTGCCTCGTACGAGGAGGAGTTCGCTACGCTGTCCGGCGATGCTTCCAAGCCTTACACTACGTACGGCCCCGAGGAGTC
GACGGTGACCGTGAACACGGCTAAGGCCCCGGCTGCTGAGGAGGAGGATGACGACGTCGATCTGTTTGGCAGCGACGACG
AGGAGGAGGATGCTGAGGCCGCACGCGTGCGGGAGGAGCGTCTGGCAGAGTACCGCAAGAAGAAGGAGGGAAAGACCAAG
CCGGCCGCTAAGTCCGTCGTGACGCTAGATGTCAAGCCCTGGGGTAAGGAACCGTCCCTTATTTCTGTCTTGCTGGAGTG
CCGTACATGCCAGCGTTGCCATACTGGATCAAAGCTAACTGTTGCAGACGATGAGACCGACATGAAGGCTCTGGAGGAGT
CGGTCCGCGGTATCGAAAAGGACGGTCTGCTGTGGGGTGCTTCCAAGCTTGTTGCTGTTGGCTTCGGCATCAAGAAGCTG
CAAATCAACCTGGTTGTCGAGGACGAGAAGATCTCTCTGGATGACCTCCAGGATGAGATTGCCGGTTTCGAAGATTACGT
TCAGTCCAGCGATATTGTAAGCTCTGTTCTGTCATATCTCTGCCTCCAAGCCATGACTGTTAATACTAACGACTTTTTTC
CTCGTGCACAGGTCGCCATGCAGAAGCGTGTAAAGGGGCGAATTGCCCCGTTTGCGACGAGTTCTCACCAGAAGATTGCT
TTTCGTAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62