GenePrediction:GLEAN_5568 Details

Name: GLEAN_5568
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:119825..118933 (- strand)
Length: 893
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:119825..119799 (- strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_146:119714..119549 (- strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_146:119473..119113 (- strand)
Length: 361
Type: CDS
Source: GLEAN
Position: GCSC_146:119026..118933 (- strand)
Length: 94
>GLEAN_5568 class=GenePrediction position=GCSC_146:119825..118933 (- strand)
ATGTATGGCGATCTTGGCAACAAACTGGTGCGTATCTCTGGTGACGCGTTCATTGTCTCGCATCGCGTGCAGCCTTTGCA
GAATTTAAGCTTACGCCCATCTGTTTGTCAGGTCCAACATGCCAAACGGACGCAGAACTTGGCACACTTGCCACCCTACC
AGACCGAAATTGTGCGAGCAGTGACGCGCGAAGTGCGCGACCTCGATAAGGACGTGGCCCAGCTGCTCGAACCTTTCCAA
GGATCTTTTGATCCCACAACCGAACCGGCAAAAGCATGTGCGCTTCTCGTTGATCATCTCGCTATGCGTCGCAATAAAAG
GTGCCTATTGGCATACCACCGCACGCGGACAGACAAGCTGGAGGAGCTGGTGTGGAATGGATCGGACGTGGTGGACCTTT
CAGAACAACAGATACGCGACGGCCCGTCTGGGGCCCGTGGCAGTGGAGGAAGGGCCGGCAGCGGTGGAGGCGCCATCGGT
GGCGGCGAGACTGGCACCGGAGACGGATACAGCGCCGGTGTCAGCAGCAGCAACGGCAGCAGCAGTCTCAGCCCCCAGGA
GGAAGACTACGTCCGGCAGTATTCGAACCTACTGGCTGCCTATAAAGGCCAGTGGACGGACATCGACCTGACCGGCAGCC
TGGAGCCTCCCCGCGACCTGTTTATTGACGTCCGCGTTTTGAAGGACGCTGGAGAAATTCAGACGGAATATGGGTAAGTA
CAGCTAAGTAAAAGAACTTTGAAACAAAGAGTGGTGCACTGTGTGATGCATTGTCCCTGACGTTTCTTGGCCAACCCAGA
TCTATCACACTGAGTCGCAACAGCCAGTTTTACGTCCGACAAGGCGATGTCGAGAGGCTGATTGCACAAGGATACCTCCA
AAAGCTGAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62