GenePrediction:GLEAN_5569 Details

Name: GLEAN_5569
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:115653..113323 (- strand)
Length: 2331
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:115653..115194 (- strand)
Length: 460
Type: CDS
Source: GLEAN
Position: GCSC_146:115061..114628 (- strand)
Length: 434
Type: CDS
Source: GLEAN
Position: GCSC_146:114570..113323 (- strand)
Length: 1248
>GLEAN_5569 class=GenePrediction position=GCSC_146:115653..113323 (- strand)
ATGGCTTTGACAATTACCGACATTGTTGGGGAAGACAGGCCTGATGCAGTTATTGCTACAACGATCACATCTTATGCGCT
GAGTTCGGTGGTGACGGGTTTAGTCTTCTACTGCATGGGCCGATTCAGGTTTGGCTACATTGTCGGCTTCATTCCCCGGC
ACATCCTCATTGGCTGTATTGGTGGTGTTGGCTGGTTTCTTGTGGCTACTGGCTTCGAGGTTACAGCACGCATAGAAGGC
AGCCTCAATTACGATATCGACACTCTGCACAAGCTGGTCCAGCGAGACACCATTCCACTCTGGGGCACACCACTTGCTCT
CTCCATTGTTCTCTTCTGGAGCCAGAAGCGTATTTCGAACAAGTACTTCTTGCCGCTGTTCATCATCGCTATTCCTTTTC
TCTTTTACTTCATTGTTGCAGTAGCCGGCTCTTTCAACCAGAGCTGGCTGCGTAGCCATGGTTGGGTATTTGAAGGACCT
CCGGCTGGCGAGCCATGGTGGTTTTTTTACACACTTTATAGTAAGGAACTGCTGTACCGCTTTTGTCCCCCGGTGTTTCT
TGTTTCAGAAAGCTAACTACAGCTCGTGGCAGAGTTTGATCAGGTGCACTGGGGAGCCATTGCCCGATGTGTTCCTGCAA
TGTTTGCACTGACATTTTTTGGAATTCTTCACGTCCCTATCAACGTCCCAGCGTTGGCACTCAACATCGGTGAAGATCAT
GCCGATCTGAACCACGAGCTCAAGCTGCACGGATTTTCCAATATGTTGCCTGGCGCCCTCGGGAGCATACAAAACTACCT
TGTCTACGCCAACACGCTGTTTTTCATGCGGTCGGGCGGCGACAGCCGTCTTGCTGGTTTTGAATTAGCAGCCTTTACGT
TTTGTGTTATGCTGGTCGGGCCCAAGACTTTTGGATTCATACCGATCATGATGGTCGGATGTTTGATATTTGACCTCGGC
TTTGAGCTACTTGTTGAGGCTGTATGGCAGCCTCGTAAAAAACTCAAGCGTGCCGAATACGTGACGGTTCGTTTAACTTG
CATTCTCAATCCATGTCGAATCAACATCAGCTGATTTGCAAAGGTCATTGCTATCGTTCTCATCATGGGAACTTACGATT
TTGTTGTCGGCATTGGAGTCGGCATTCTCCTGGCCTTTGTGTCGTTGATAATTCAGACCTCCCAGGTGTCTGCCATTCGC
GCAGCATACAGTGGCGACATTGTCAACTCGACAGTCCGGAGAAATCCATCTCAGCAAAACTATCTTCGTATAGTTGGCTG
TCAGATTTGCATCATCAAACTGGAAGGTTACCTTTTCTTTGGTACCATCGTGGGGGTGGAGGACAAAATACGGGAGCTCA
TCTCGGACGATTCTTTCCATCGTCAGCCTATCCGCTACCTGATTCTCGATTTGCGCCATGTGACGGGGCTAGATTACTCT
GCTGGGGAGGCCTTTAACACGATCAGCCGGCTACTGGATGGAAAGGGCATCCAGCTTGTGGTGAGCGGTGTGGATGCCGA
AAGCGAGCTGGGTCATGACCTGCGCGCAGTCGGGCTGGGCGAAGATGACATAGAGGTGGTCTTCTTACCGGAGATCAACA
CCGCGCTGGAGCTTTGCGAAAACGAGCTGCTAAAGACGTTGTATGCAAGCCAAGAGGCGCATTTGGGCGAGGGCATGAAG
GCTGGTACGACCTCCGGGGCCAATGGCGCGATCGCTACCACTGGCTCATCGTCCCGTCGACACCTGCTCATCGACGAGGC
TGGTGCTGGCCCCTCACTCGACATGCTGGCAAGCTCGCCACGCCGAAACCACCTGCAGGCTGCAGCACGGGAGCTGCTGG
ACAATACGGAGGATCGCCGGCGCTCCAGATGGCAGAATTTCAGCGACCCTCTGCGGCTGATGCTGCAGATCTTCCAGGAT
GTCAGCGACAAGGACGTGGACTTCTGGTTCAGGGCAGGTCGCTACTTTCAGCGGCTTGAGTACGTGGCCGGGGACATGCT
ATTCTCAGCCGGTGCTGTAGCAGAGGGCTTTTTCCTGTTGGAGAAGGGGATCGTTCGGGCCGAGTACAGTCTCGCACACG
GGCAGTGCTACCACGAAAACATTGTGGCAGGGACTACGTGCGGTGAGCTGCCATTCTTTTCAGAGACGGCCAGAACTGCA
ACTGCGTATGCCGACATGGACTGTACCGTGTGGGTCCTCACCCGTGAGGCGTGGCAGAGGCTCCAAAAGGAGCATCCGGA
TGTGGCGAGCGAGCTGCTGCGCGTATCTTTGAAGCTCACGGCTGAGCGTATGTCCACCGTGCCGTCATCGACTATGCTGA
TGGCCGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62