GenePrediction:GLEAN_556 Details

Name: GLEAN_556
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:582965..584174 (+ strand)
Length: 1210
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:582965..583008 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_97:583114..583133 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_97:583208..583258 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_97:583317..583964 (+ strand)
Length: 648
Type: CDS
Source: GLEAN
Position: GCSC_97:584056..584174 (+ strand)
Length: 119
>GLEAN_556 class=GenePrediction position=GCSC_97:582965..584174 (+ strand)
ATGGCCGATCGGTACTCCTTCTCGTTGACAACATTCTCGCCCAGGTGAGCAGCTCTGTTGCTTTTCCGGTGATGGTGGCT
CTGTGCATGCGCCGCTTTCATCTGCATATCTGTATCTATACAAGGACTAACCTGGTGATGATACAATAGTGGAAAGCTGG
TCCAAATTGGTTCGTTGTTCCTGAGTTGCAAATTGCCCTCCTTGTAAAATCACAGAATGCGGGCACTAACACTAAGCTCG
TAGAGTATGCTCTAAATGCAGTCAACCAGGGCGTTACGGCTCTGGGCATCAAAGGTGAGCACTGCTTTGGCTCAAGCATT
GGCTTTCGGCCGCCTCATCTAACCTATCGCAGCCACAAATGGCATTGTCCTGGCCACGGAGAAGAAGTCATCATCTCCGC
TCGCAGATCCCGCATCCCTCTCCAAGATCTCTCTCATCACACCCGACATCGGCATGGTGTACGCCGGCATGGGCCCTGAC
TACCGTGTTCTTGTCGACCGCGCCCGCAAGGTGTCCCACTCGGGCTACAAGCGCATCTACAACGAATACCCTCCGACCCG
GATACTGGTCCAGGACGTCGCCCGTGTCATGCAGGAAGCCACTCAGTCTGGTGGTGTTCGCCCCTACGGTGTCAGCCTGC
TGGTTGCCGGATGGGACGAGGGCATTCTGCCTGATGAGGAGCTCGAGAAGGAGGCAGCTGCAGCAGCGGAAGCCAAGAAG
GCAGAGGGTGAGGACGTCGAGTTCACTGATGGAAAGAAGAAGCTATCGGGCAAGACAGGTGGCATCCTCAAGGGTGGGCC
CATGCTGTATCAGGTAGACCCGTCTGGCAGCTACTTCCCCTGGAAGGCGACGGCCATTGGCAAGAGCGCAGCTTCGGCCA
AGACCTTCCTGGAGAAGCGGTACACGGAGGGACTAGAGCTGGAAGATGCCGTGCACATTGCGCTGCTGACGCTGAAGGAG
ACGATTGAGGGCGAGATGAACGGCGAGACGATTGAAATCGGTGAGTGGCCTCTTGATGAAAGCAGAAGGACCTACACCAT
CTTTCTGTCGTGGCTATTATCGTAAGCTGCTTGTACTAATACCCGAAACAGGCATTGTTGGACCTCCGGCAGACCATTTG
CTGGGCACTGAGGGCGTCGAGGGTGCACGGGGGCCGCGGTTCCGCAAACTCACACCGCAAGAGATCGAGGATTACCTGAC
CAACCTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62