GenePrediction:GLEAN_5571 Details

Name: GLEAN_5571
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:87781..85868 (- strand)
Length: 1914
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:87781..87633 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_146:87566..86081 (- strand)
Length: 1486
Type: CDS
Source: GLEAN
Position: GCSC_146:86023..85868 (- strand)
Length: 156
>GLEAN_5571 class=GenePrediction position=GCSC_146:87781..85868 (- strand)
ATGGCGGGCCAACAACGCATAGCCATTCTTTCTGTCTATGACAAGACAGGTCTTTTGGACCTGGCCAAGGGGCTAATTAA
GAACAATGTCCGCATCCTGGCATCTGGAGGAACATCAAAGATGATTCGTGAGTCAGGGTTTCCGGTTGAGTATGTCCCCT
TTCCTGATTAGACATCCCCTGCAAGCCTGCTAATTTTGGGGTGCTCCTTTTACAGGGACATCTCTGCCATCACTAAAGCT
CCTGAGATGCTGGCTGGCCGCGTCAAGACGCTGCATCCTGCCGTACATGCAGGCATCCTAGCACGCGACCTTGCTTCTGA
CGAAAAGGATCTTGCCGAGCAGAACATCGAGAAAGTTGACTATGTAATCTGCAACCTCTATCCCTTCAAGGACACTGTCT
CAAAAATCAACGTGACGGTTCCCGAGGCTGTGGAGGAAATCGACATCGGTGGTGTCACCCTTATTCGCGCTGCTGCCAAG
AACCACACCAGAGTGACAATCCTCAGTGACCCAGCTGACTACGCCGAGTTTATCAACGAGCTTGAGGCCGGCGAGATCAA
AGAATCTAGCCGCAAGCTATACGCCCTAAAGGCTTTCGAGCACACTGCTGACTACGATGCTGCAATCTCCGATTTTTTCC
GCAAGCAGTATGCTGGTGATGGCTCTCGATACCTCTCGTTACGGTATGGTGCCAACCCACACCAGAAGCCTGCCGCCGCC
TACGTCAAGGAGGGGCGCCTGCCTTTCACTGTGCTTAGCGGGTCACCCGGCTACATCAATTTGCTCGATGCCCTCAATGC
TTGGCCGCTGGTGAAGGAGCTCAAGGCTGCGCTTGGCCTTCCTGCCGCAGCCTCCTTCAAGCACGTCTCGCCAGCAGGTG
CTGCCATCGGTACCCCGCTTTCTGCCGACGAGAGGAAAGTCTACATGGTTGATGATATTCTGGGCATCGAGACATCTGCT
CTTGCCCAGGCTTATGCACGCGCTCGCGGTGCCGACCGCATGAGCAGTTTTGGTGACCTGATCGCCCTTAGTGATGTTGT
TGATGTTCCTACAGCCACCATTATTGGCAAGGAGGTATCGGACGGTGTCATCGCCCCCGGTTACGAACCAGACGCTCTGG
CCATCCTCAAAAAGAAAAAAGGTGGTCGTTACCTGGTCTTGCAAATCGACCCAGAGTACGTGCCCACCGGCCGCGAAACG
CGCACAGTCTTCGGTGTAACTTTGGCTCAACACCGCAACGACATCCTTGTCTCGCCCAAGTCCTTTAACACCATCATCAC
ACCAAAGGATGCGGCCGGCCCGCTGTCTGATGCAGCCCTACGCGACCTCACGATAGCCACAATTGCCTTAAAGTACACCC
AGAGCAACTCAGTCTGCTATGCAGCTCGGGGACAGGTGATTGGTTTGGGTGCAGGCCAACAGTCTCGGATCCACTGCACG
CGATTGGCAGGTGACAAGGCCGACAACTGGTGGTTGCGGTTTCATCCACGCGTGCTTGGCATTCGGTGGAAGAAAGGCAC
AAAGCGCCCTGCGAAGAGCAACGCTATTGATCTCCTTGTTGGCGGTCAGCTACCTAAAGATGGCCCTGAACGTGAGGCAT
TCGAAGAGGTTTTTGAGGTAGTTCCGGAGGCTTTTTCGACCAAGGAGCGCGAGGGCTGGCTGGCAACGCTTACAGATGTG
GCTGTGTCTAGCGACGCTTTTGTGAGTTTTCTTCGAATCTGCCATACTAGGTCCAGTCTAACTAATATGCTGCGAAAGTT
TCCCTTCACGGACAATGTTTATCGGGCGGCTCGGTCAGGGGCTAAGTACATCGCGGCCCCCGGCGGTAGTCAAAATGATA
TACCAGTATTTGAAACTGCTGAAAAGTTAGGCATCACATTTGTTGAGCAAAACATTCGGCTTTTTCACCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62