GenePrediction:GLEAN_5572 Details

Name: GLEAN_5572
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:83442..79736 (- strand)
Length: 3707
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:83442..83397 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_146:83297..80984 (- strand)
Length: 2314
Type: CDS
Source: GLEAN
Position: GCSC_146:80744..80005 (- strand)
Length: 740
Type: CDS
Source: GLEAN
Position: GCSC_146:79935..79736 (- strand)
Length: 200
>GLEAN_5572 class=GenePrediction position=GCSC_146:83442..79736 (- strand)
ATGGACGGGCAGAAGCTTGCTAGCCTGCTCCAAGAGAGCCAAATACGTGCGTGTTTCATATCTGTGGCTGATTGACTTCT
CCCTCGATTTTTCACCTGCAAAAATATTTATTCCCATTTCTGACCTTACAACTCTTTTATTCTAGCGGACACAACAAGAC
TCAAGGCGATTACCGCCGAGCTTCAAAAGAGCTATTATGCGCACCCAGAGTCTTTGTTGCTGCTCATTGAAATTGTCTGC
ACGAACAGCGATGTTGGCGTCAGGCAGCAGGCGGCCGTTCAGGCCTCTAGACTGGTGCCAAAGCACTGGCCTTCTGCTTC
GGCAGACCAGAAAAAGGCAGTTCGCGAGCACCTGATGGACGCCACTTTAAAGGAGCAAAATGCCAAGTGCCGCCACTCGG
ACGCGCATCTTGTTGCTGCCATTGCGACACATGATTTTGACGACGGTGAATGGCCTGAGTTGCTCCCTGCACTCTTCACG
CTTGCTACAAGCAGCGATGTCTCACAGCGCGAGATCGGTTCCTACATTATGTACAGCACTGTGGAGGCGAACCCTGTGAT
CTACAAGGACCACGTCAAAAAGCTTCTTCAGCTCTTTGGTCAGCTTATCAAGGACCCCAGCAGTGCAGATGTCCAAATCA
ATGCAGTCATGTCCATTGGCGCTTTGCTTGTTCTTATTGAGGGCGACGAAGAGGAAGATGAGGAGGCCGTTGGCGGTGTT
CGGGACTTGGTTCCGCTCATGGGCATTGTGCTCAAAAACTCCGTTGACGCTGGTGACGACGAAAAGATTCAGCAAGTCTT
CGATGTCCTCCAGCAGTTCCTAGTTTTCAGTCCCGCTTTTATCGGCAATCATCTCAAGAGCCTTCTTCAGTTTATGATCG
ACCTCGCCGCAAATACAGAAGCTGATGAGGACGTTCGTGTTCAGGCTCTTTCTTTCCTGACCCAGACTGTTCACTACCGT
CGCCTAAAGATTCAGGCCATGCGCGATATGGCTGCGCAGCTCGTTGTCAAGGGAATGCAGATCTTGACAGAGATCGGTGA
CGATGAATCGCTCGATGACGAAACACCGGGTCATGTTGCTCTGAGCCTTCTTGATGCTCTAGCTAGCGAGCTCCCCCCTC
GCCAGGTGCTTGTTCCCCTACTCGACGAGTTTCCCAAGTACGCTTCGTCGGCAGATCCGGCCTTGCGCAAAGCTGGCATA
CTGGCCCTGGGCAATTGCGCCGAGGGCGCCCCGGACTTCGTCAACACCCAGCTGAAGACGATCCTTCCTATCGTCATTCA
GCTCTTGAACGACCCAGACGGCACTGTGCGCCATGCCTCTTTGGTCGGCCTCACGGGTTTGGCCGAAGAAATGCCCGATG
ACATTGCTATTGAGCACAAAGAAATCATGGCTGCCCTTTCCAGAAATCTACAGGCTGCCATGATTCCGACCCAGGATGAG
CAAGTTGCCAAAAAGAATGGCCAGGTTATTCGTGCCGTCTGCTCTGCATTTGACTCTGTGTCTAATGGCCTCAAGTCCGA
TGTGATGAAGGAGTATGCGCTCCTGATGATCGAACCTATCGGGCAACTCTTCAGCCACCCAGATACGCGTGTGAAGATCG
CGGCAGCCGGCGCATTTGGAGCGATTGCAGAATCACTCGAGAAAGAGTTCGTGCCATACTTTGAAAAGAGCATGCAGGCC
CTTGGCTCCTTTGTCACTGTGACGGGTGAGGATATGGAGCTACAACTTCGCAGTGCCGTTCTCGACTCCATTGGTCGCAT
CGCTGTTGCTGTCGGCGCACAACCGTTTCAGCCGTACGTGGTGGACCTCATGCGGGCCAGCGAGGAGAATCTCAGTCTGG
ATGATGATCGGTTGAAGGAGAGTAGCTTCATCTTCTGGTCGTCTCTGGCTAAGGTGTATGGGCGTGAATTCAAACCTTTC
CTTCCAGGTGTCTTCAAGGCCCTGCTCGACGCGTTGGATGGTGATGATGAAGAAGATGTTGTCCTTCAGCTCACGGAAGA
GGAGAAAGCCATCATTGCTTCTGGGGGCTCCACCAGTGGCAAGAAGCTGAACATCGACGATCTCGACATCGACGATCTGG
AAGATCTGATGGACGACGAAGACGACGACGATGATTGGGCTGGTATGGACAGCGAAGCCGAGGAAAAGGAAGTCGCAGTT
GAGGTGCTTGGTGACGTCATCACCAACGCGTGTGGCGAAGAGGAAATGCAGGAATACCTCGAGAAGGCAGTTAGCATTGC
CAAGGACCTTATGGAGCACCACCACAGCGGTGTTCGTAAGGCTGCTATGGGCATGCTTTGGCGATCGTATGCCCGGGTCT
GGCAGCTGACTGCGGAATCGACCGGTTTGAAATGGCAACCCGGCTTCCCGCCTGCACAGACTCCAACGCCGCTACTTTCC
AAGTTGGCGGATTTGGTTACGAAGCCGACCCTTGAGCTTTGGCAGGATGAAATTGAACGGTAAGCCCCTCCTTGATGATC
CATCCTTGACTTTATGCGCCCATCAAGCACGAATCTGTCGAACCTTCATGATGAACACCTTACGGTATACCCAGCTCACT
CTGACGCACTTGTGCGAATGCTGCGAACCCGTTTTAATCTACTTCTGATCTCTGGCTCACTACTACCCTTATGTACTCAC
ATGGAATTTGCCGAAATGATTTATTCGTTCTGAACACTGACTGGTTTCCGTATTTCAGGGACGTGGTAACGGATATCAAC
CGCAATGTTGCTGCGACTCTGGAAACATGCGGTCCTGCTATTATTGCCCAGGAAAACGCAATACAGGAAATTGTCACCGT
TTTGGGACAAATTATCACTCGGGCGCACCCGTGCCAACAAGATGTGGGTGACGAGGAAGATGCGCAGAACGCCGAGGAGA
GTTCAGAGTACGACTGGCTCGTCGTCGAAACGGCTCTTGACGTTGTGATGGCGTTAGCGACTGCCATCGGACCGACGTTT
GGTGAGCTGTGGAAAATCTTTGAGAAGCCTATCATGAAAATTGCCAGCTCAAATGAGTCCTATGAGCGATCCTCAGCTGT
CGGCACTATCGGCGGCTGCACCGAGAGCATGGGTTCCACTGTTACACCGTACACCAGCACACTGCTGAAACTCATTGTGC
ATCGGCTGAACGACGAAGACCTCGAGACGAAGAGCAATGCCGCTTATGCAATCGGTCAACTCATCAGCAACTCGACGGAT
AGCAAAACATATCTTTCCAGCTTTCCCATTGTTTTGGAAAAGCTGGAACAGCTGCTTGCTCTTGATGACACTGGCCACCG
AATTCACGACAACGCAGCGGCGGCTGTATGCCGGCTGATCACAGCTCACCCTGACGTTGTTCCCATTGCCGAGTACCTGC
CCTCTGTTGTCCAGCGTCTTCCTCTCACGGAGGATTACGAAGAAAACAAGCCCATCTACACGTGCATCTATCATCTGTGT
ATGTCCCATCCCAGTCGCTGGGCCCTAACATCTTGATCTTACGGAAGCTGACAATTTTCGCTTGAAGATGATCATAATGA
GCCGACTGTTCAACAGCTCACACCACAGCTGATTCCAGTTTTTGAACAAGTTCTCTCTCCCCCGGAGGACCAGCTAGAGA
AGGAAACCCGAGAGCTGGTTCAGCGAACCGTGCAGGCTTTGCACAAAGCAAGGCCTGAGCTCTTTCAAGGCCGCGAAAGT
CTGCTGAAGCTATCAGGTGCAGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62