GenePrediction:GLEAN_5573 Details

Name: GLEAN_5573
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:75293..73714 (- strand)
Length: 1580
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:75293..74816 (- strand)
Length: 478
Type: CDS
Source: GLEAN
Position: GCSC_146:74738..73714 (- strand)
Length: 1025
>GLEAN_5573 class=GenePrediction position=GCSC_146:75293..73714 (- strand)
ATGAAAACAGAGGAGATCTCAGTCGAAGCTGAGCTGGTTGTTGTCACCGAGTCTTCAGTGCCTGCCTTGATAAGAACTAC
GAAAGACAACATCAAGCCTAGCCCAACGTCCGATGACGCTCACCCCACAAACTGCAACCGATCTCGCTCTGCTCGACACT
CACAACCACGTCAGCCACGACAAGGCCGCCGCACAAAGAAGTTATCTACCGAAGAGAAGGCCAAAGTTCTGGAGGTGCGA
AGACAGCGTGCATGTCTGCGGTGTAAAATGTTGAAAATACAAGTAGGCACCATCACCAACACCATGCCATGCATTTGCAG
TAACCCTAACTCTTTATGTTCCTTCCAACAACAGTGCTCCAAGGAAAACCCGTGCAAGCCATGCTTGTCTTCTGCCGTGC
GAGGGTATGAACGGAAGGTTTTGTCCTTCTGTTATTGCGTGCGAACGCGCTTCGTGGATGTCGATATCTTCCAGAGCTGT
TTGTACCTCTAACACTTCGTTATGCTGTTACATCACTTTTGATACTCAGCTAACCGTCGTGCGTCTTGTGTATAGCCGGA
CCTGGACCTACGCCAGAGGTCCCGATGTCGGTCCGCACCCTGATAGACCAGATCAGGCCTCACCACTCGCAGTCCCTGGG
GGATGACATCTTTGAAGACACACTGATCCGCTGGCTGACAAACCCGGACTATTCGCCTCCCGACGGCAGCATCGTTGCTT
TACTCTGCGACAAAGTGGGAAACTCTGAGAGTCTTCGCCGTGCCGTGGATGCCGACCTGACAACCGACTTTCGTATATTC
CTCTTTACCACCTCTCTCGCCCATACCGGTTGGAACGGCCACGTTGCCCACCGAGATCTCTGCGTTGCCGGACACTTATG
CGGGTCGCGAATTGTGCGCCGCCTTGACCGTATTTTGACTCCTCAGTTCCTGTCCAAATGCGACAGAGAGACGCACCGAG
CCCTCCTCCTCCTCGTCTTTGGCCTCATTCTCGGTGTTGGCTACTCCACCCGAGTTACCACGTCACCATCCTTCCCACAT
GCCTTGCTAGGAGCTGAAATGCGTCACAGTCCAACGTTGTGGTTAGCAATGAAGGAGCACCTCGCCCAGATGTTGGCCCA
TCACCTCATCTTCCTTGGCTCGATACTTGGCATAAAGCTGGATACCGCCTCCGAAAAGACCATCATCGACACGGCTGTGA
ACCGTTGGAACAAGCCGGAGCAAAACGTGTGGGCTGGGTTTGTGGGAGACTCGCTGCCTTCAAAGATCAGCCCATCCAAG
CCTGCCGCCGCGCTGGATGATTTCAACAACCTTGAGGATGTTGGTCAAAAGCAGCAGCCGCCGGTCTCATCGGCTCCACT
TCAGACTCCGACCCCACAGACGACGCCCATCGTGGCATTACCTTGTCCAGATCTCGTGGACCTGCAGACCATGCCTCACC
TTTCCGAAAACCCGGCGTCGTATCTATCCATGACGGACGAGGACTTCGACGGATTGGCACCACCTATCGTAGACTTAGGA
GAGCCACGTCCGCCTCCTGGCCTGAAAGGTATGACCCGCAAGGCTGCCCTTGCAATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62