GenePrediction:GLEAN_5574 Details

Name: GLEAN_5574
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:67700..66297 (- strand)
Length: 1404
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:67700..67532 (- strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_146:67461..67380 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_146:67316..67094 (- strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_146:67028..66297 (- strand)
Length: 732
>GLEAN_5574 class=GenePrediction position=GCSC_146:67700..66297 (- strand)
ATGAGGTTTCCATCATGGCTAAGCTGGTATAAGAAGCTAGAGTACCGCGACATCAAAGAGTACTCCAACGCCGTCGTATC
TGGAAAACGAGACCTGAGTCCTGATGGCCGCGGCAAAACCGCCGTACCGGCACGTCTGAGGCTCGAGAGGGTATTGCAGA
ACAAGACATGTAAGCTGCGTCTCAGCGTTGTGATGGTTTCGACTGGACGCCTATTCTCTGATTTCTTCCCGTTGTATAGG
CAGCCCCATGTCACTTTACGACTTTTACATGTATCTAAAATACATCGAGTTCTCGCCCGAGAACCTGGAGTTCTACATAT
GGTATGGTTGCCTATTTCTGCTGCACGCGGAGAAGTTCCCGTCTCTAACCCTGAATCCTGCCAGGTACAAGAGCTATGAG
GAGGGTTGGAAGAAGAACCTCTGTGGCGACTTCGACGCGGCCTCGTTGAGCAGCTCTGTGACGAGCACAGCGTCCCTAAG
GAAGGCGACCGAAAACCCGTCAGAAGTGTTCTCGACAGATCCCGAAATCGGCAAGTCTTCTGTGCCCAGCCCCGCTATCT
GCCTGCAACTGCTGACTGTTCAGCCGAGACTCTTGCGTGCATCACGGGTCTGATCAGCGTTCATGCCAACTGTGCCACAG
ACGGCTGCTCACCCGCTTTTCAATTGCCCAAGCCGCCATCCTCATCGTCCAGACAGGCCAAGACGGGTGCCACACTCAAC
GTCGTGGATGCCAGCGCCGGCCGTCGTGCCGAACTGGGCGCCGTCATCAAGATTTTCCTTAGGCCCGGCGCCGAGAAGGA
GCTCAATATCCCGCCTGCCATGCGTGACCACGCCCTCGCTGAACTGCAAAGCTCAGCTGACCCGACCCACTTGAAGGCCG
TTGCCGATCACGTCTACCTGCTGCTGCGCAACTGCTCCCATCGCAACTTTGTCCGTCTCGGCGTCTCTAACGGCACAATC
GAGACCATCTGCGTCGCCACTGGTCTCGGCATTGCCCTCACCATCGCCGGCGTCCTCTGCGTCCTGCTGCGCGCCCTAAC
CCCCCACGTTGGTGTCCACTCGCGCTTCGACGTCTTCGCCGCGTGGCCCATGTGGTGGCTTGGCCTCAGCCTCATCCTCT
CTGGACTGCGCGGCAGCTGCTTCTTCCTCCTTCTTTTCACCCATCGCCAGCCCCTGCCTTGGGAGCGCTTCGACGATAGC
GCCAGCATGCTTTCCCATCGTTCCGGTTTTATGAAGAGGATTTCCCGTCTCATGATATTCGACCGGAAGCTGCGCGTCGC
CGACACGCATCTGCGTCGCCTCCAGCATCGCATCGTCGTCCAGAGTCTGCTCTTTGGCGCATTCTTTGCCTTCATAGGCG
TGCTGATCTTTATCTTCCTGCCCATCTGGTCTGAGACTGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62