GenePrediction:GLEAN_5575 Details

Name: GLEAN_5575
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:63584..62688 (- strand)
Length: 897
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:63584..63557 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_146:63499..62688 (- strand)
Length: 812
>GLEAN_5575 class=GenePrediction position=GCSC_146:63584..62688 (- strand)
ATGGCGGCCGAGCAGCGAAAGCTCTTGGGTAGGTGACCTCTCTTTGCCTCCCGCATACATCGGCATGTCTGCTAAACGTC
TCCAGAGCAACTTATGGGCGGCGGCATAAGCTCTCGCAGCACACAGCTCTCCCTGAATGACCCAAAGGTATGCCGGTCCC
ACATCGCCGGCACGTGTCCCCACGACCTGTTCACAAACACCAAACAAGACCTCGGACTGTGCCCAAAGGTACATTCAGAC
GCGCTGAAAGAGGAGTACGAGGCGCTGTCGCCGAGCGAGCGGGCTAAGCACGGCTTCGACTACGACTACATGCGCGACCT
ACAAAAGTACATTGAAGATTGCAACCGGCGCATAGAGGCGGCGCAGCGCCGGCTGGAGAAGACGCCGGACGAGATTCGCC
AGACGAATCAGCTGCTGAAGACGATCAGCGATCTGAAGAGCACCATCGCCAACGGTCTCGTCGAGGTGGAGGTGCTCGGT
GAGGCCGGTCTCATCGGTCCCGGTATGGACGAGTTCTTCCGCGTCAAGCAAGCGACGCAAGCCAAGGCAGAGCGAGAGAA
GGAGCTCAAGGCCCTGAGCGACACTAGCGGCCCGTCGGGCCACCAGAAACTGCAGGTGTGCGACGTGTGCGGTGCATACT
TGAGTCGGCTGGACAATGACCGCCGGCTGGCGGACCACTTTTACGGAAAGATGCATCTGGGGTATGCGCAAATGCGCAAG
ACGTACGATGCCCTCTCCAAAGAGCTGCGCTTCAAGGGCCGTCCACCCGTAGGTGCCGACGGTGATGACGGGGGCGCGCC
GCCAGGACCCGGGAGCGGCTATGGAGACGGTGCTTGGGGGCGGTCACGAGGTCCACGGGGTGGTGGCGGAAGGACCAGGA
ACAGGCCCCGGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62