GenePrediction:GLEAN_5576 Details

Name: GLEAN_5576
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:56170..54523 (- strand)
Length: 1648
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:56170..56036 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_146:55983..55151 (- strand)
Length: 833
Type: CDS
Source: GLEAN
Position: GCSC_146:54868..54523 (- strand)
Length: 346
>GLEAN_5576 class=GenePrediction position=GCSC_146:56170..54523 (- strand)
ATGCTAAACCTGCGGTGGCGCATGCTAAACCTGCGGTGGCGCATGCCACTGGGCCCATTTCCGTGGCCTGTGGTGGGCAA
CGTTTTCACTACCGGCGAACAAGCCGTGGATCTTCTTCGAGTCGTTATCGAGACGGTAAGATGCGCCGCTGATCACGTTT
TGGATTGGGCGCAACCCGACGGTCTAGATCAACGATGCCTGGTGTGCGCATGAGATACTAGAAAAGAAGGCACAGGTGTA
TGCGTCACGCCCGCGTATGGTGGTCTTTGGCGAGCTCGGTACCGGTCAGACGAACCTGGTGACGATGCGGGTGCGCTCAG
CTGCCGAACGAGACCATTGGCGCATCCACCGCAAACTGATGCACCTCGGTGTAGGCGTGCAGGCCGTCCGCCGCTACCGT
AACGTACAGAACAACGTAAGCAAGGCTGTGGCACTCGAATTCCTCTGCGAGCCAGCCGCATTTGTTCGCCACCTGGAGCG
TCATGCCACCAGCGTTGTGTCTGTGCTCGTCTTTGGTCGTCGTGTGCCCGCTTTGACGATCCCATCACCGAGGTCATTTG
CCCTGATGCAGCTCGCCGCCGACCTCAACGTGCCCGGAAGATCTGTCTCCATGCCCATGGAGACCTTTCCCATCCTGGCC
CGCTTCCAGCGCTGGGTCCCGTGGATGCGTGGCATCAGGAATCGCAACCAGAAGGGAGGCCATTACTTCTTCCACTTGCT
CGCCCAGGAGGCCGTCGAGCAGCAGTCAGCCGAACCGACCGAGGACAAGGTCGGCATCCCGCGCCCCTTTGCAGATGCCC
TCTTCACCGAGGCCCTCAAATACGACTTGGCGACAGAGGAGCTCTCTAGTTTGACGGGAAGTCTCTTCGGCACTTGCTCT
GACACCACCTCGAGCACGCTTGTCACCTTTGTCCTAGCCTGCTGCGCCTTTCCCGAGCCCATGAGGCGGGCACAGGCCGA
GCTGGACCGTGTTTTTGGCAGCAGCCGCTCTCCTGATTGGGATGACTCCGACAAACTGCCGTACGTGGGCGCTTTTCTCA
AGGAAGTCTTCTGATGGCGTTCCGTTGCCATCATCGGCGGCCAGCCGCACTCACCAACCCAGGATGACCATCACCACGGC
TGATTGATTTCCGAAGGCGCATGGGTCCCGGGAAATATCAGGGCCATCCATCACCACGAACGGGAATATCCCGAGCCTGA
CCGCTTCCTTCCTGACCGCTTCTTTCCCGAGAACGAGCACCACCGTCCCTTTCCTAACGATCGCGACTACATGACCTTTG
GCTGGGGCCGCCTTGTCTGAAGCGGTCAGGCCCTCGCAGAGCAAGGCGTCTGGATCGCCGTCGCCCGTCTGCTATGGGCC
TTTACCATCCAAAAAGCCCGCGATCCCAACAGTGACCTTGATATCGATGTCGACATCTTCGCCTTTACCAACGGCCTGAA
CATGCGCCCACAGCCCTTCCGCTGCGATACTCAGCCGCGGACGCTTGAGATCGGTGCGACGATCGAGCGCGAAGGCAGGG
AAGCTTTGCTTGCCTTGAAGCCACTGGATGGTGAGAGCAGATACCGCATGAGCACCTTCTACCAGGCGCAGAAGCGGAAA
TTGGCCAAAAATCCCATCATCGATGAGGTTGAACAAGTGCGGTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62