GenePrediction:GLEAN_5577 Details

Name: GLEAN_5577
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:37047..34461 (- strand)
Length: 2587
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:37047..36949 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_146:36890..36878 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_146:36816..36424 (- strand)
Length: 393
Type: CDS
Source: GLEAN
Position: GCSC_146:36358..35775 (- strand)
Length: 584
Type: CDS
Source: GLEAN
Position: GCSC_146:35716..35462 (- strand)
Length: 255
Type: CDS
Source: GLEAN
Position: GCSC_146:35390..34648 (- strand)
Length: 743
Type: CDS
Source: GLEAN
Position: GCSC_146:34587..34461 (- strand)
Length: 127
>GLEAN_5577 class=GenePrediction position=GCSC_146:37047..34461 (- strand)
ATGTCAACACAGGGCTCTACCACGGACGCGTCCAGCAAGATGGGCAGCAAGAGGCGAGCACCGATGAGCTGCGACCGATG
CAAGAGCCGGAAGACCAAGGTAAATCTCGTCCAATCTGCGTCGCTATCATGGTAGCTACTGATACATTGACTGGCAGTGC
GTGGATCCAGGTTCGTGCTATCTTGGGAGGACGGAGGGGGAGAAGAGATACATGGGCTGACGGTCGGATAGTCCCAGGAC
CTTGCAAGTTCTGTGCCAGCATCGATGCAATCTGCCATTTGGATCCGTCGCGGCGACGGCAGAGGCCATACTACCACGTC
TCTGAAGAGGAGTTCCGCTACATGACCAAGGCGCTCGAGCACTTCCTTCCTCATGTCGAACTCAGCCTGCAGTCGCTCCG
GGAGGTCGTCCAGTCACTCGATGCTGCCAACCCGGCCAACCGCCCGTCTGTGGCCGTGTCAGAGGCCTCGTCCGACTCGG
TCGTGGTCCTCAGTGACGATCACCGCACGCCACTCTTCGACCCCTGCCCTGTCAAGGCCGAGGAGAGTGCTGTGAGTATC
AAGGAGATCGATGAGATGCACGGCAAGCTGGGTTGGCTACGCATCGACTCCAAGGGAACATACCGTACGTACCAGAAGCT
CTCGAGGCTGCTGAGGCTGCCGTCCTGCTGATAATACTTCTGGACGCAGGCTACGTCGGTGCCGATTCCGGATACACCTT
CCACGCCGCAGTGCGGTCGCTTTGCCAGCGGCGTGAGCCCGAATTTTCCTGCAGCAGCGACCTCGTCCCTCCCTTTACCG
CTGCGCCTCCGCTGCCACCACCGTCGCTTCCCGACTCATCTGCCGGGCGAGTCTCCCCCGGCCTTTCGGTGCAACATAAC
CAGATCCACAGCCAGCAGCGACACGTCCGCACTAGCCTGTGCCGTGTGCAGATCTTCCTGCCGCGCCGTGACCTCTGCGA
CCGCTGTGTCTCCCGCTTCTTCCGCGACATCCAGTCCGTCTACTGGTTTGTCTCCGCCGAGCGCTTCTATGCCGTCCTCG
ATCGTCTATACGCTGGTGACCTTACCAGTGCGACGCCCGCCACCCTCTGCTCGCTGTACGCCGTTTTGGCCCTGACGTGT
GAGAGCGAGGCTGTTCAGGCTGCTGAGGCCGCTGAGGAGGCTGCCGCTGCTGAACCGCCGCCCGCCGCTCGATATCTATC
GCTCGCTAAGATGCTCGTGCCTGCACTCTGCGACGAGGCCGACATCGACAGCGTTCGTGCCCTCTGTCTTCTCGTGCGCC
ATTTCTGCCGCCTGCTGCCTATTCCGGCTCTATCCGCTGACGTTTCTCCAGGGCCTCGCTTTGCAAAGCTCCTTGTTCAG
CAACACCGCCTACATTTACATCGGCGCTGCTGCTCGAATCGCCCTCACCTTGGGCCTGCATTTGCGGAAGACCATCGAGC
CCAAGGGCTTTTTGCAGCGTCAGGTTGACCTGCGCCTGTACTCCACCCTATTTCTCCTCGATCTCGACGTCGCCCTGTGC
TACGGCAACCCGCCCGCCATCACCGAAGACCATGCCGCCGGCAAGTTGCACGACCTCTCCGAGCAAGTAAGATATGCCGG
CCATATCCCGTCCACTCCTTCTCCCCCCTCTCCCCCGTGCTAACCGCCCGCCTGCAGATCCTTAGTCCGGGCTCGCACAT
GCCGCTGCACTACCTCACCGTCTCCTGCGAGCTCGCCCAGATCAAACGCCGCCTGGGCCGGCTCCTGTACGGATGTGACT
CGGCCGTGTATACGGCACACACCCCGCTCTCCGATTGTCGACCGTCCATATCGGCTGTGAACGATGTGCTGTCCGTGCTG
ACCGAATGGTATGCTGCCATTCCGCCCCATCTATGTGACGTCTCCAGAGCTGCTCCTTTCCACCAGCGCTCCGTGTCTAT
TCTGCATCTGCGCTATTGGAGCGCCACCATCTTTGCCACCCGCCCCTTTCTATTGTACAGTGCCTTCCATCCCATAGGCC
TTGCTGCTCTTCCGCCTGCTAAGCGGGCCTCCTTCGAGGAGTTTTCTACTACCTGCATCGAGGCTGCAAGGAAGTCCCTG
GCCGTAATAGGCCTCATGCGAGATGCCGCCCTGCTTAGTAGCCTGGTCACGCTGGATAGCAGTTGCCTAATTGAGGTACT
CCAAGTCTTCTTGCTCGCCCTAGCCCGCGGCCAGAACGCACGTGCCGATGACGTCCGCATGTGCCTTCACACTTTGCAGA
GTATGGAGCAAGTCTTCTGGACACATCATATGCTCACTGAGGTCATGGCCCAGCTCAAGGAGAACGGCCTGCTGAATGAC
GATCGCAGCTTCAGCCCCCAAAAGGAATCACCGGAAAATTACTTTCTCGACATAGGCCAGCAACAGCAACAGGATGAAAT
GTATGTTGCCCCCACGAAAGGGAGATATATGGACGCATTCTCAACTGACTACGTGAACAGGATGTCGGGTGTCATGAAGG
CCTGTTTTGCTGATCTCAATGACCCTTTGTATTCTATGCACGATGACGGCACTGATTTCGGCCCCATGCTTAGCGAGTCT
CTGCATGATGACCTCTTATTAGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62