GenePrediction:GLEAN_5578 Details

Name: GLEAN_5578
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:31050..28184 (- strand)
Length: 2867
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:31050..30970 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_146:30924..28474 (- strand)
Length: 2451
Type: CDS
Source: GLEAN
Position: GCSC_146:28249..28184 (- strand)
Length: 66
>GLEAN_5578 class=GenePrediction position=GCSC_146:31050..28184 (- strand)
ATGGGGGGCTTATACTACAAGGGGCTGTCGCTTCCAGCAGTTTGCCTGAGCCCGGAGGCCGGTTCTCCCGCTCTGGTGCC
CGTAAGTATCCTAAGAACCCCCAGAAGACTGTTGTATCTAACGCAGAGAACAGCAAGCGTGGAAACTAGGTCTGCGTTAC
ACACTGTCCGAGCGAGCAGTGACCAAAACATACTGAACGGCGATGACGATGATGAGCCTGTCCTTATGGAGGTTAGGCAA
ATCAAGTCGCAGGCCGCGGAGAACATGCTTGATCGCCTTCAGAATACGGTAGCGGCAAACGTCAGCTTTGTCTCTCACGG
CTTCACTGCCATTGGTGATAAGGTGAAGGAACTTAACGACACCCTTGGTGAGCTTCAGGCGCTGGGAATCCAACATGTTA
CCAGTCTTCCAGAGCTGGTTTTGGTTGGAGACCAGTCGGCTGGGAAATCCAGTCTAATGTCTAGTTTTTCCGGCATCTAT
CTGCCACGCAGTGAGGGAGCTTGTACCAGGTGCCCGGTCCACATTCGGCTTTCTGGCTCACATGGCGGGTCTTGGTCGTG
CCGAATATCGCTACAACAGGACTACGAATATCGCCCGCCTGCTAACGTCACACGTGCCAGCCCGTTTGGGCCGTGGTTTG
AGCAGCGCAGAGACATCAAAGAGTTTGCCACGTTGGGTGATCCAACTCGGATTGAAGAAACTCTTCGATGGGCCCAGAGA
GCTACCTTGAATCCTAGCAGAGACCACAGTCTGTACAAACCTGGGATTGGCGAGATTTGGAAACGCTGCCAGGGACTTGA
TCTCGAGTCAATTCAAAACGAAGCTGCCTTTAGTCCCAACACAGTTGCACTCGATATTTTGGCTCCTGGTCTGGCAGATC
TGAGCTTCTATGATCTTCCAGGGGTATTTACAAGTGCGAAACAAGACGAAGATCAGTACTTGGTAAAAGTCGTGGAAAAC
TTGACGGCAAAATACATTTCTCACCAACAAGCAATCATTCTTTGGGCGGTTCCAATGAACGCCGACCCGGAAACGTCTTC
CACCTTTTCTATTATACGAGCACAGAATGCCCAATCCCGGACAATTGGTATCATGACAAAAGCCGACCTACTTCCTCCCG
GTCCAAGTGCGCCGTCACAGTGGACGTCAATGCTCCGTGGCGAGCAGCATCGCATTGGGCATGGATATTTCATGACCGCG
CGCCCGGTAGTCACGCAAAATCTAATTCCTGACGATATGGTACCACAACGAGACCCTTCCCGACCTGCTGACGATCTAGA
ACGCCAGGGTGCGTACGAAGAGGCTTTTTTCAACAAGCAGCTCCCTGGGCTGGCGAATCAAGAGTGGCGCGAATGCTTCA
AGGAGTTTGAGGACAGATGTGGCGTCAGCCGCCTCGTCGCTTTCATGTCTCAGCAACTCGGTGCCGAATTTGCAAAGTGG
TGGGTTTATGAACAACATAGGCTGCGTCCTGCCATATTCCGGCTACTACCAAGAAGATGTACCTTGTACAAGCTTGTTTC
TGACTGTTTGCCTATTAGTTTACCTCAGATCAAGGAAAAGGTGACTTCAAAGCTACTGGATGTAAACCGCGAACTGGCCA
AGCTCCCCGATATACCAGAAAATCCAGAGCTGGAGGTGCGCCGCAGTCTTGCAGATTTTGCCAGCCGCATAAAAACAACT
TTGGAAGGTGCATCATTGTCGCCGTTGTGGGGGGACGTCGTCCAGCAATTTCGACATGAGATATTAGATCTCAAACCGCG
ATACATCGTCAAGACCGAAATCTCGCCACTAAATAGACTCGATACAAACGGCCGGATCGACTTAACACATGTCGACGACT
CAATAAGCTCAACACTATCTCCAAGACTGTCGCACGACACAAGACGCCGTCGGTTAGATGAATACCTAGAGGGTCCGGAT
CCTCATGGTCCCAGCACACCAAGTAAACGACAACGGGGAGAGGGCCCGGTGAAAGCAGAGATACCGTCAGAATGCAGCTC
TACTTCCAAACTCCGCGCTAAATCCAGATCGCTTCAGGAGGTGCGAGCGGTGATCGCTTCTAGGAGCAAGCCAGGGATGC
CAGGAATTGTCACCGAAGATGTGTACAACTCGCTTTGCATGGAAGCTGTGAGACCATGGAGGGGCCCTCTTCAACAGCTT
TTGGATAGGACGTATCGCCTTCTGGACAATACGCTCCATCAACTACTATGCGAGGCTTTCAGTAACTTGCGGGAACGGCT
TGTCTTCAAGAAGGCAGCTTCAATTTTGAAGAAGTATATTGTTGACCAATTTCATTCCGTGAAGGACGTGTTGTTGAAAA
ACTATGCGCTCGAGACCCGAAAATTTTACACGTTAGACAAAGATAGCCTCGCTAGACACGAGCACGCCGAGGCCAAAATT
TTGGCACGACACCGACACTACTATCGGATGGTTGCGTACCTTGGAGACAAAGCATCTGACCGATCACCACCTCGGCCATG
GGAGCTGATGGCGGAAGAAGAACGAGCTCGTGAAGACGTCCGCATGAATCAAGAAGCTACAAAACTCGGCCCAGACCCGT
TCAAGGCAGAGCTGAGTGTATGTGCCTATGTGCGCGGCTATTACCTAACAGCGAGCACACGCTTTGTTGACACTTGCACA
CTGAACATCATCTCTGGCCTTATCCCCGATGTTACCGAGTCACTTTCTAAGTGGCATATCGACAGCCAGTTGGGGGTTTT
TGACGGCATGAGTAAGAAATTTTCCACCCTGTTTATCACGTTTCCCGAACTTTAATACAACTGCTAACTATCCCAATACA
GCCTCCCAATCCTTTTGCGATCTTATGGAGGAAGACAAAACGACAAGCGATAGACGAAACGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62