GenePrediction:GLEAN_5582 Details

Name: GLEAN_5582
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2285424..2281803 (- strand)
Length: 3622
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2285424..2285385 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_173:2285305..2283132 (- strand)
Length: 2174
Type: CDS
Source: GLEAN
Position: GCSC_173:2283081..2282787 (- strand)
Length: 295
Type: CDS
Source: GLEAN
Position: GCSC_173:2282728..2281803 (- strand)
Length: 926
>GLEAN_5582 class=GenePrediction position=GCSC_173:2285424..2281803 (- strand)
ATGAAGTTCGCCAAGGAACTCGAGCAGGAGCTCGTGCCTGGTAAGAACCGCTTCTCACACTGCTGTCTTTCGCTTCTACG
CGTTCTCTTTCGCCTCTCGTCCGCTTCTAACATCTTCAGAGTGGCGGATCAAGTACCTAAACTACAAGGCAGGGAAGAAG
TACGTCAAGGCGGTGAGCCGGGCGATAAGTCGCGCCAATGCCACACCGACAGGCGACCTGCCGCGACGACTGTCACAGGG
CTTTTTCGCTCCCGGCAGTCCGTTCAGCCCGGCAAAGGCGAGCAAGAATGCGGCACCGAGCGGACCGGATGCAGACGAGG
AGGGGGTGGCGTCGCTGCGAGACAGCCCGGCGCCTCTGGGACGTCTGAGATCTACACCGAAGCAGACGACACAGCACGCG
TCCGGGTCTGGACGAGTTCAACCCGGCACGAACCAGGCCGAGCGACACGGCCTCACGGGACCGATTCCAGAGCGGTCGCA
GCACTACGGCAGTTTTATGGCCTCGGCCCGGTTTCGCAGTCCGTCTGTGGCCACGGATAGCTCTCGGCTCTTTGAACTAC
CGGCGCCGGCGATTCGCGTGCCGTCTCACACCAACGGGAACGCGCCGGACGAGTCGTCCGGCGCCGAGACGTCTGCCACG
GCTGCTGCCACCGTGAGCACCGTAGCCGCCACCGGTGCCGTGACGGCAACGCCGCCCGGTCCCTGGATGCCTAATATCCA
GCGACGCAGCCTGTCGATGGCAGCGGGCTCGCAGCTGTCCGGCACGCTTCCTCTGCCGTCTCGGGCGCCGACGTTCCCGT
CTCTGTACGAGCTGACGCCGCGGCAGCGGCTGCGGCGGCTGTTCTCGGCGGCCACTCCGGCGCAGTGGGGCGCAGACGAC
ACCAATAAGAACGACATCGGACTGCGGGCGCTGGATGAGGTGCGCGAGCGCGAGCTCGACTTCTTTCGGCTGCTCGACAG
CGAGCTCGAAAAGGTCGAGTCGTTTTATAAGCTCAAGGAGGAGCAGGCGGGCGAGCGGCTCAAGATGCTGCGCGAACAGC
TGCACGAGATGCGCAACCGACGGGTGGTAGAGATCCGGGCGTCGAAAAAGCACAGCCGGTTCAGTCCATTCGGCGACGGC
AGCAGGACTCCCGTCAGCAAAGGCAACAACAACGGCAAGCCCAGCGTGATCGCAGGCGACGCGCTAGCTGAGCCGCACAG
CAATGAACATGACAGCTGGATCGGACCGATCCGGGCGAAGCTATTCCGGCCGGGGCCCAACTCCAAGGCGCTGCAGGCGA
TGGCGCAGACGCCACGGATGTCGGGCGGAATGGTGTCGCCGGCTGCAGCCCCTGACGAGCGGCGGGACTACACCCGGCGG
GCACCCGACGACGACATTCCGTACCGCACGGCCAAGCACAAGCTCAAGCTGGCGCTGCAGGAATTCTACCGCGGACTGGA
GCTGCTCAAGTCGTACGCTATCCTCAACCGCACGGCCTTTCGCAAGCTCAACAAGAAATACGATAAGGCCGTCGGGGCTA
GGCCGCCCTACCGCTATATGAACGAGCGGGTCAACCGGTCCTGGTTCGTCAACAGCTCCGTGGTGGACGACCTGATCGTG
GCTGTCGAGGACCTCTATGCCCGCTACTTTGAGCGTGGCAACCACAAGATCGCCGCCGGCAAGCTGCGCGCCCTCACGCG
CCGCCCCGGCGACGAGTCGGCCAGCGCCTTTCGCAGCGGCCTTCTCATCGGCGTCGGCTCCGTCTTCTCCATCCAGGGCA
CCGTCAGCGGCGCCCGGCTGCTGCGCGATGCTGACCCCGTCGTCCACCAGCAGACTAGCTACCTGCTACAGATCTACGGC
GGCTACTTCCTCATGCTGTACCTCTTCTCGCTCTTCTGCCTCAACGGCCGCATCTGGACCATGAACAAAATCAACTACTC
CTTCATCTTCGAGTTTGACCCGCGCTCCCACATCGACTGGCGCCAGCTCTCCCAGTTTCCCAGCTTCTTCCTCCTGCTCT
TTGGCCTCTTCTTCTGGCTCAACTTCTCCGTCCATGCCAATCCCGACCTCTTTCTCTATTATCCCGTTATTTTGATTGGT
ATCACCCTCGTCTTTCTCTTCCTCCCGCTGCCTACTCTGTGGCACCGCAGCCGCAAATGGTTCCTCTATTCTCATGTGCG
TGAACCCTTTTTACCCGTCTTGTCTACTACTGACACGTTGCAGTGGCGCCTCTTTTTCGCTGGCCTGTATCCGGTCGAGT
TCCGTGACTTTTTCCTCGGTGACATGTACTGCTCGCTCACATATGCCACCTGCGTAAGTCCCTCGTCTGCTGCTTAGACC
TTGCACCTGCTAATTAGCCACAGAACGTAGAACTCTTCTTCTGCATTTATGCCCACGAATGGGATGACCCTTCCCAGTGC
AACTCTAGCCGGTCCCGCCTCCTTGGCTTCTTCTCGACCCTCCCGTCCATCTGGCGTGCTTTGCAGTGCATCCGCCGCTA
CCACGACACTAAGAACGTGTTCCCTCACCTCGTCAACTGCGGCAAGTATGTCATGACTATTCTGAGCTACGTCTTCCTCA
GCATGTACCGCATCAGCGGGACCAACGCCAACCTCTCGCTGTTCATCGTGTTCTCAGTCATCAATGGCCTCTACACATGT
GAGTCCCGTTGGCCGCGCTTTGCGATCCTGGCGGAACTAGAACTGACTGGCCACAGCGATCTGGGATCTTTTCATGGACT
TCTCGCTGCTCCAGGCCGAGTCCCGCTACTTTTTGCTGCGCGATATCACGGCCCTCAAGCACCGCTGGGTGTATTACGTA
ATCATGTTCATCGATCCGATCCTGCGCTTCTCATGGATCTTCTATGCCATCTTCACGCATGACTCGCAGCACAACACGAT
CGTATCCTTTATGGTGTCCTTTGCCGAGGTGACGCGCCGTGGCATGTGGGCGCTCCTGCGAGTTGAGAACGAGCATTGCG
GCAACGTTGCGCAGTACAAAGCGTCCCGCGACGTGCCGCTGCCGTATCACCTGCACGTGACCAGCGCTAGGTTAAGCCAC
GAGTTCATGGGCGTGGCAGACGACGAGGACGAGGTCAGCATCGGGCGGTCAACGGCTGTGGAAGAAACCCCGTCGATCCA
GCCGACGAGAAAGGACAGCGTGCATGTCTCGAAGCAGCAGCAGCAGCAGCAGGGCGTTGCCGGGACGCCCGGATCCGGAG
CAGGGCCGTGGGCCGATTACGGCAGCAACGTCGAGGAGGGTGCGGCCGGGCGGCCGGGCACGGCAGCGGACGGGTCGATG
GCAGGCGGCACGACGTTGCGGCGACGGCGGACGTCGACGACGGCGACGGGCAAGAAGACGATTGCAGCGATCATGGCGGA
GGCACACATGCAGGACTTCCAAAAGAAGCGACAGCCCGAAGCACCGCCGGCCGTGGGACCGCTACCGAGGCAGATGCACG
AGGCCAGCAGCGACGACGGCGCCGAGGATGACGACGACAGCGACAGCAGCGATAGCGATGGCGGCATCGGCATGGTCCTT
GCCGGTGTGGCCGACGGTGACGATATGGACAGTGAAAGGGGTGGTGGTGGCAGTGGTGGTCGAAAGCGGTCGACGACGGA
TGCCAGCCGCAAAGACGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62