GenePrediction:GLEAN_5584 Details

Name: GLEAN_5584
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2266055..2263666 (- strand)
Length: 2390
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2266055..2265692 (- strand)
Length: 364
Type: CDS
Source: GLEAN
Position: GCSC_173:2265624..2264806 (- strand)
Length: 819
Type: CDS
Source: GLEAN
Position: GCSC_173:2264734..2263785 (- strand)
Length: 950
Type: CDS
Source: GLEAN
Position: GCSC_173:2263719..2263666 (- strand)
Length: 54
>GLEAN_5584 class=GenePrediction position=GCSC_173:2266055..2263666 (- strand)
ATGTCCCACCTCAACTCTTGGGAGGACGACCCAGCAGCCCAGGATGAAAACCTGGCGCGGCAGGCCCAGCAGCAACTGAA
CGTCGGCGGCGGTGGTGGTCGTGGCAACTTCCATGTCGGCGCTGCTACGTTCCAGCCAGGTGCGGCTACCTTCAACCCTG
GCCAAGCTTACGGAGGGGCACCCAGCTTCGTTCCTCAGTATCAACAGCCACAGCAGCAGCAGCAATACTACAACCAAGGA
TATGGATTTCAACAGTATGGCCAACAACAAACTGGCTTTGACCAGCACAACCAGGGATATGGTGGTTCTGGGTATAACAG
CCAGCAGGCTAGCTACCAACAGGGTGGCTACAACCAAAGCTATGGTATGCCGCCAGGGAATGTCTTCCCATGCCCTGAAT
TACGGCATATTCTGACTATTGAGAAATAAAGGTCAATACAGTGGCGGCTATCAGCAGCAGTCTTCTCGTGGTGGCGCCGT
CGGCCAATACGCTACCAGAGACACCCCGACGATTGCAAAGCGGACCGATTCAGCAGCAGGTACAGCCGCGTCAGCGACAG
CATCGACAATTTCTCCGAAGCCAGCTGGAAACATCGGAGCCAAGGTCTTGAGCATTGGCGGCGACGCAGCAAAGCCGAAG
GTGGCAAAGGTGCTTTCTATTGGTACCCCAGCACCTGCAAAAGAAGAGTCGAAGAAGGAGGAGGCAGCCCCGAAGGTGGA
CAGCACTAGTGCTGAGGCTGGTGCGAAGATCACGGCGGCCAAGGCCATCGAGAAGACAACCGGCGACAAAGCAGGGGGTA
GCGGAAAGACGTCTCCGTCTCCGTCTCCATCATCAGGTCGTTCCAGCCCTGCGCGGGCCGGCACGGAAAAGATCACACGG
GATGTTGATGCCGTGCAGAAAGAGCAGGCTGCAGATGTGGACGATGATACTTTAAAGGAAATTTATGGAAAGGAGCACGT
GAACATCATCTTTATCGGTCACGTCGACGCTGGCAAGTCTACATTGGGTGGGTCGATTCTCTACGTCACAGGCATGGTGG
ACCAGCGGACTATGGACAAATACAAGAGGGAGGCCAAAGAAATGGGCCGGGAGACCTGGTATTTGTCCTGGGCGCTAGAT
CTTACAAACGAAGAGCGGACCAAGGGCAAAACTGTCGAGGTCGGTCGTGGCCATTTTGAGACAGATAAGCGTCGCTACAG
CATTCTCGATGCGCCTGGCCACAAAACTTATGTGCCAAGCATGATTGGCGGTATGTTGCAAACCCAGTCGCCACTGCGTC
TCATCTAACTGCGTTGTTTTTTGCTAATGCTCGTACTTCAGGCGCCTCCCAGGCTGACGTCGGTATTCTGGTTATCTCTG
CCCGGAAGGGAGAGTACGAGACCGGCTTTGAGAAGGGTGGACAGACGAGAGAGCATGCTATGCTTGCCAAGACGCAGGGT
GTCAACAAGCTGATCGTTGTGATCAACAAGATGGATGACCCGACAGTCAACTGGTCGCAGGATCGGTACAAGGAGTGCAC
AACGAAGCTGTCACAGTTCCTCAAGGGCACGGGCTACAACCTGAAGACGGACGTGTTCTTCATGCCGATTGCAGCACAGC
AGACGACAAACATCAAGGATCGGATACCTAAGGGTGTGGCAGACTGGTACAACGGGCCGTCTCTGCTGGAGTATCTCGAC
AACATGCAGACCCTGGAGCGCAAGCTGAACGCACCGTTTATGATGGCCATCAACAGCAAGTACCGGGATCTCGGTACCAT
GGTGGAGGGCAAGATCGAAGCAGGTGTAGTAAAGAAGGGCATGGGTCTTATCATGATGCCGAACAAACAGAACATCGACG
TGACAGCCGTCTATGGCGAGACAGAGGACGAGATGAGCATTGCGCAGTGCGGCGACCAGGTGCGGCTGCGGTTGCGGGGC
GTCGAGGAGGAGGACGTTCAGCCCGGCTTTGTGCTGTGCTCGCCGAAGCGGCTGGTGCACAACGTGAAAGCTTTCGAGGC
GCAGGTGCGCATTTTGGAGCTGAAGAGCATTTTGACGGCCGGATATAACTGCGTGCTACACGTGCACTCGGCTATCGAGG
AGGTGACCTTCTCGGCCTTGTTGCACAAGCTGCAGAAAGGCACCGGTCGCAAGAGCAAGGTGCCGCCATCGCACGCAAAG
AAGGGCGAAAGTATCATTGCACGGCTAGAGGTGATCGGGGGTGCTGGCTCGGTCTGTGTCGAGCGGTTTGAAGACTACCC
ACAGATGGGACGTTTCACGCTTCGTGACCAGGTACGTATGAACTTGCGTTGGAGAACGGAACAGAGTCAAGTAACTAATT
CTTGGTATCATGAAAGGGTCAAACAATTGCCATTGGCAAAATCATCAAGCTCATCACGGACAGCTCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62