GenePrediction:GLEAN_5585 Details

Name: GLEAN_5585
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2261785..2258726 (- strand)
Length: 3060
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2261785..2261548 (- strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_173:2261331..2261178 (- strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_173:2261103..2260839 (- strand)
Length: 265
Type: CDS
Source: GLEAN
Position: GCSC_173:2260787..2260713 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_173:2260642..2260580 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_173:2259418..2258726 (- strand)
Length: 693
>GLEAN_5585 class=GenePrediction position=GCSC_173:2261785..2258726 (- strand)
ATGGATGCCGACCCGCTGAACCCGCCCATGCCTGCACTGTCACAGTCCCCGACCTTACTCCCACAAGATGCACCCGACGG
CACGCTTGGCGTTATCGAAGACAACCCTCATACAGGTGACAGTGGCGCCGCCAGCCGCCATTACGCACAATCACATTCCC
AGTCCCAGTCCATGGATCAGAGTTTGAGCGACTCGCCACGATACGGCTACGGAACTGCCGACGACTCGGAATCGAACGGT
CGGTTTGGCACGCCGCCCTTGTCTGCACAATCGATGTACACTCAGCAGCAGCCACAACAGCTCCAACAGCCCCAGCAATT
ACAGCAACAGCCGATGTTGCCTCAGCTACCACTTCAACAGCAGTACACCCAGCCACAGCAATACTACCAGCAGACGCAGC
AGCAACAAGTACAGCCCCAACAGCCCATATCAAGGCCGCCTTCGGGGTTGTCAGGACATGGTAGTGCCAGTGCTGGTGGT
GCTTACCCGGATCATGCGTCTCGGGGCAGCGGTGCACATGCCGAGCCGAACAACGGACGAAATCACGTTGTGATCAAGGT
GGGAATGGTGGGCGACGCACAGATCGGCAAGACATCACTCATGGTCAAGTACGTTGAGGGCAGCTGGGACGAGGACTACA
TCCAGACCCTGGGCGTCAATTTCATGGGAAAAAGACGATCAGCATCCGCAACACAGAAATCACCTTCAGCATCTGGGATC
TGGGTGGCCAGCGCGAGTTTGTCAACATGCTGCCGCTTGTGTGCAACGACGCCGTGGCCATTCTGTTCATGTTTGACCTA
ACGCGCAAGAGCACACTTAACAGCATCAAGGAATGGTACCGCCAGGGCCGCGGCTTCAACAAAACGGCAATTCCAATTCT
GGTCGGCACGAAGTACGACCATTTTGTCAACTTCCCTCGCGAGGACCAAGAGGAGATCTCCAACCAGGTAGGGCCTCCTC
CAGCAAGCTGTGGATAACAGGTTTTCTAACCGTCCCAGGCTCGTCGGTTTGCAAAGGCCATGCGTGCAGCACTCATTTTC
AGCAGCACCAGCCACAGCAACAACGTTCAAAAGGTAGGTGGTGGCGGCTGTCAGCTTCACGCCCGCCGCTGCATCAATGC
CTGAGCTGACCAAGCTGTCCTAGATATTCAAAATCGTGCTCTCAAAGGCCTTTGATCTCAAGTGCACAATACCCGAGATC
GAGAATGTAGGAGAGCCATTGTTGCTGTATCAATCATGCTAGCCCGGGAAATGTACGATATGACAGGCAAAGACGCCCGT
GCCTGCTGCCTCCCTTCTGTTCCACCCCTTCTTGCACATTCTGCGCCGATGCGCCTATTTTTTAGTCTGATATAATCCTG
CTTCATACCGTCATTCTTTTCTTTTTTCTCTTTTGTTCTGATATTGGTGGGGACAGTCAACGTCTGTGGCCAAGTGATAG
GAGAAGGGTAGGAGCAGAGGACGAGATCGAGTCGGGGCCAAGCACTGTTCGTGTATTAGACAAGACGATAAAGCCGGGAA
TGTGTTGCAAGATGCTCAAGGGCAGCGACCAGCTGCAGACGTGAGCAACCGGAGTGCTACCCTCTGGGGCTTATGTCTTC
TGGTATAAGCTTTCCAAACCCGTCGTCCATTGTCATTCATTATATTGCGGTTTGCCGACTTTCTGGCTGGGACGGAGCGC
GTGGCATACTGGAATGGCTGTCTCCGAAAGGAGAAGCGCACGATCCTTACTTACTATCTATACACCCCGATTTCTAACAT
GTTGTATTTTTGTCGTAAAAACCCTCCCTGGAGATCTCCTATTGTCATCAACCATTGTTTATATAGAGGGGAAGGATCGA
TAGACGGAGCTCCTGAATCGGCAAGTGCCAGAGACAGGAGATCGGTCTCGGGTCACCATGAGTCGGTCAGCATATTCTAT
TGACCTTATATTCCAACCCAGCAGCTGCTCCTCTTGCAGTCTCTCCTCTCTTGCTTGATGCTCTAACAGGCCTACCATTC
GACAGATCCTGCCTCAGAGTTTCACCATTGTTGGGAAACCTCGTCCTCACATCATGCTTATTAGCCTCTGCTTTTATCTC
ACATCTTTCTCTTCCTACCCAGCATCAACGAAACCCACACCTAATAATCATAAACAGAATACACAATCGATCTCTCGGTT
GGCCTTTGCAACGTTGACCGAAGAGGAGGCTTGCAACGGGCGGAGGCAAACATGGGCCAGGCGTGCTGCGCCCTGGAAAG
ACGAGCCAAGCGGGATGTGTTAAATGAAATAATAGCCGACATGGAAGCGCTCCCAGAACTACGACCCGTCACCCCTGAAC
CAATATCTCCAACTGCACTAGGTGTTTCAAGACTGTCACCTTCGCAGTTTGCCCGCGTGCGGCACCGGGGACGCCAGCAG
CCACGACGTCGAAACAAGCTCATGAAACAGAGAAAACAGAAGATGCCAATGTCTGAGCCGGCCACGCTCGCAACACATCC
ATCGCGTATGCTGCTCGCATCTTCCGAGACAGCAGCGGCCCGTCCGGAATGGAATTCATGGGCTGATGCCATCGGCATCG
AGTCCGGCCTGTGGCGACGACGTAGACATGCTTTTAGCTACGATGGCTCCGATGACCGCCCGGAGACGGAACTAATCGCC
CCTACACCATGGCGGCCGATCTGTCTGTATCTCCCAGCGGTCGTGGGGACTGACGGAGTGGGATACTTAGAGGCACAGGC
TTCGTCGTGTCCAGCTAGCACCGCCACGCACGTTGACGAAGCATCAGCCTCGCAAGGCTCGAGCGTATACTACTCGGTTT
TTTCGTCGCCCCGATCGCCCGAGGAGAGAACGCCGACGGGCACACCACCAACTAAGATCCGTGACCGCGGCTTTCTCGAT
GCCGTCTTGGCAGCTGCTAATATACCCTTGGCATCTGGGCCGTTGTCACATATACCTTCCAGGCTGTCACAGGAGAGCAA
CGATACGGTTGTGCGAGTCAGGCCGCTGCGTGTGGAGGACTATGCTTCGGACGCGACACCAGGAAAAGACAACCAGGACA
ATGAAGAAGGGGTGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62