GenePrediction:GLEAN_5586 Details

Name: GLEAN_5586
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2258060..2253790 (- strand)
Length: 4271
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2258060..2257822 (- strand)
Length: 239
Type: CDS
Source: GLEAN
Position: GCSC_173:2257750..2256899 (- strand)
Length: 852
Type: CDS
Source: GLEAN
Position: GCSC_173:2256754..2253790 (- strand)
Length: 2965
>GLEAN_5586 class=GenePrediction position=GCSC_173:2258060..2253790 (- strand)
ATGGCTACAATCAACCCTGCCAGCGCCACGTCGGCCACCATCAGCCAGCTGTTAGTAAAGCTGAGCGACTCGGACCCCGA
CTATCGCTTCATGGCGCTGAACGATCTGCTATCAGTCCTGGTTAGCGGCCGGCCAGAGATTCTGCAAAACGACTACAACA
CGGCCGCACGGACAGCGGACCATCTGGTCCGGGCCCTGGACGACCAGAACGGCGAGGTACAGAACCTGGCGATTAAATGG
TATGGCAACGATAGTGTGCAAAGTCTATACAGCATAATATTGACGGACGCTGACTGCCATGTTTCTCCAGCCTCGGAGGT
CTTGTGCACAGACTGCCATCGCCAAATATCGGGCCGCTCATCGAAAAGCTGTCGACGCTGAAGCTGAGAAACTCGGTGGA
CACGGCGGTGCAATCGCTGGCACTCATTACGGTGATCGCAGCACTACCTAGCCCGACACCGGGCGACCCGCCGTCCAAGG
ACACGGTGGAGGCATACAGCAGCATCAGCCGGATGCTCATCCCACGGCTCATCGGCCGTCCGGTATCGTCGGTGAAGCCG
ACAAACGCCAAGAACCTGCGCCACGCGTCTCGTATCGAGGACATGCTGGAGGTCAATAGCAGCATCGACATGACGGCTGA
GGCGGTGGACGTGCTGATCGAGGTGGTGCGGTCTTTTGGGATCCTGCTGCAGCCCGTGGAGGTGGAGGCGCTGCTGGACG
TGGTGGTGGCGGTGCTGCACGACAGCCGGGCGAGCTCGGTGACGAAGAAGCGGGCGGTGGTGGCGGTGGTGATCCTGGCG
GTGTACCTCCCGGACGAGGCGCTGTCGGGCTTTATCACGCAGACAGCAGACGTGCTGAACAGCGAGACGGTGTCGCCGGC
GACCCAACGGCTGTACATTTCGATTTTGGGCTCGATGGCGAGATCGATGGCGGTGCGGTTCCGCAGCTACATCAGCATTG
TTGTGCCGTACACGTTGCAAGCGCTGGACCAGGAGCAGCTGGACGCGCAGCTGGAGAAGATCGGAGAGGGCGACGACTCG
GGCGACTTTAACGACGTGCGAGAGTCGGCGCTAGTGGCGCTTGAGGCGTTTCTGGCGTCGTGCCCGAAGCAGATGCGTGC
GTTCACGACGGAGACAATGGGAGCGTGTCTGCGCTATCTCAAGTATGACCCAAATTACGTGGGTAACTCGGACGACTCGG
ACGACAACATGGACGAGGGCGACTCGGAGAACGGCTCGGACGACGAGTTTGGCGACGACGATGAGTTTGAAGCAGACGCC
GGGTTCGACGACGACGACGACGCCAGCTGGAAGGTGCGGCGGTGTGCGGCGAAGGCGCTACACACGCTGATCTCGACACG
GAGCAGCGGCGACCTACTGGAGAACGGATTGTTGTACCGGGTGGCGGCGCCGGCGCTGATCCGGCGGATCCAGGAGCGGG
AGGAGAACGTGCGGCTAGAGGTGATTGCGGCGTTGTCGGTACTGGTGCGCAAGACGGGCGAGGGGATGATCCCCGAGTTT
TCTCTGGACGGCAGCGACGGACAGGATGAGATGGCGCAGCTGCCGCAGAGCCGCAAGCGGCGGAGACAAAGCAGCTCGGT
GGGCGGCAGGGCGTTGGGAGGGAGCGGCAGGGGCGAGGGCGAGGTGTCGTCGCCGACGCTGGAGCGGGCAACGATTCCGG
CGACTGGGCCGCGTGCCGACCTAGCGGAGAAGACGCCATCGATTGTGGCTGCGTGCACGAAGCTGCTCAAGGGCAAGCAG
ATACCGACGAAGCAGGCTGTGATCAACCTGCTAAACGACATTGTGACGGTACAGCGTGGAGGGCTGTCGGAGTACCTGGA
GCAGATCCTGGAGCCGGTGATCGAGGCGGTCAAGCCGGCGACGGCAGCGGGTACGTCGGGTTCGCTATCGGTGGGCGGCG
GCGGTGGTGGTGGTGGTGGTGGTGGCGGCGGTGGCAACGCGTCGGCGACTCCGGCGACGCTGCGGGTGGCGTCGCTGCGG
TTGATGGGCCACATTGTGAGCATGCACGTGTCGGTGACGCTGCAGCCGTACCTAAGCCGGATTGTGGACGGGCTGCTGGC
AGTAGTGCACGACCGGTTTTACAAGATCTCGGCAGAGGCGGTGGGAGCAAGCGAAGAGGTGGTGCGGGCGATCACGCCGC
CTCGGGCGCGAGCATCGGTGGCGTCCAAGTTCAAGCCGGAGCTACAGAAACTATACGGTGTGTTGATGGACCGGACGACC
GGGTCGGACGTGGATGCGGAGGTGCGGCAGAAGGCGATCCACGCACTGGGCACACTCCTGTCCCACACGGGGTCGGCTGA
GGGAGCCGGGCTGGTGTCGATTGAGAAGCGGGCGGCAGCTCTAGAGGCGCTGCTGGAGCGGCTGCGCAACGAGACGTCAC
GGCTGGCAGCGGTGCGGGCAATCGACACGGTGGCAGCATCCGACCCAGGCTCGGGCTTAGGATCACGCTTCGAGGCCGGC
TGGGTGCGGCAGGTAGCGTTGGAACTGGCAGCACAGCTGCGCAAAGCCAACCGGTCGCTGCGCGGGTCGAGCATCCAGGC
ACTGCGCCACCTGGTGCAGAGCCCAGATGCACAGGGGCAGTTGGACGTGGCGACAGTGGAAGCGTTGGTAGCAGCGCTGC
AGCCGGTAATCACAGACAGCGACCCACACCTGCTGAGCCCGGCGCTGCGGATCTTGGCAGTGCTGGCACAGGAGCAGGCG
CAGCTAGCGGTGACCAAGGAGATGATCGGATCGCTGTGTCGGCTGCTGCAGAGCAGCGTGGCGGCGACGGTGTTGGAGCC
ACTGCTGCAGCTGGTGACGGTGGTTGGACGTAGCGGACAGGGACAGCCGCTGATGGCCGGACTGCTGCAGGACGTGGGGA
TCGCGGGCGACCCGGCAGTGGTGGGCAAGGTGGTGGGTAACCTGCTGGTGGCAAGCGGCAGTTCTGCTGGCGTGACGATC
GACAGCTTCATCAAGGAGACGCAGACGTCCAGAGCAGACCCGTTGCGGGCGAGCCTGGCGCTGGCCGTGCTGGGCGAGGC
AGGCCTGCGACTGGGCCGGCTGGGAGCGACATCGCCGATCGAACCGACGCTGTTCCTGGAGCAGTTTGCGAGCGAGTCAG
ACCAGGTGTCAGTGTCAGCAGCAGTGGCTATGGGCCGAGCGGCAGCCGGCAACGTGGGGCTCTACGTGCCGGTGATACTG
CGGGAGATGGCGAGCGGCAGTAGCACGCAGTACCTGGCGTTGCAGTCGGTCAAGGAGACGCTGCAGCAGGTGGCTGTGGA
CCGGACGGACATCAACGCATACACGGCAGCGATCTGGGCACAGCTGCTGCAGGCGGCCGGGACGGAGAACAACAAGGCGG
TGTGCGCCGAGTGTTTGGGCCGGCTGGCGATTATCGCGCCAGCGACGTTTGTGCCGCGTTTGCACGAGCTGCTGCAGGAC
CAGGGCCAGCAGGCGTCGCGGGCCATCGCGGTGCAGGCGCTGCGCTACACGCTGCCCGAGTCGGGTGAGGCCTTTGACGC
AGTGCTGGGCGAACACCTGGGGGCGATGCTGAAGACGGCCCTCAGCGACGGCGACATGGAGATCCGGCGGCTGGCGATGA
CAGCGCTCAACTCGGCGGCCCACAACAAGCCGGAGCTAATCCTGGGACAGCTGGGCGAGCTGCTGCCGTATATCATGGAC
GAGTCGCGGGCGAAGCCGGAGCTGGTGCGCGAAGTGCAGATGGGCCCGTTCAAGCACCTGGTGGACGATGGGCTGGAGGT
GCGCAAGGGTGCGTACGAAACGCTGTATGCGCTGATCGAGACGGCGTTTTCGCGCATCAGCCTGATCAGTCTGTTTGAAC
GCGTGATCGACGGCCTGGCCGACGACCACGACATCCGTGCCATGTGCAACCTGATGCTCTCACGGCTGGCCTATGTGGCC
CCGGCCGAGACGGCGCGCCAGCTGCCCAGCATTGCCGACAAGTATCGCGTCATCCTCTCGACCAAGCTCAAGGACAACGC
CGTCAAGCAGGAGCACGAGAAGCAAGAGGACGCTAACAAGAGCGTGTTGCGTGCCACGCTGTTGCTGGCCGACCGCCTGC
GGGCCCTTACTGGCGAGGGCTCCAGTGGATCGACCAATCCCGGTGGTACCTCTGTTTCGGGCACTTCTGGCCTCGGCCCC
AACAACAAGTGGTCCCAGTACTGGGACTGGGTCAACAAGACGTTTGACGCCCAGCTGCGCGTGCTCCGCGACGAGAACCG
CGAGCTCGGCACGTCGCTGACCGCCTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62