GenePrediction:GLEAN_5589 Details

Name: GLEAN_5589
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2189206..2187285 (- strand)
Length: 1922
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2189206..2189145 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_173:2189050..2188956 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_173:2188690..2187285 (- strand)
Length: 1406
>GLEAN_5589 class=GenePrediction position=GCSC_173:2189206..2187285 (- strand)
ATGGTTCTTGTGGCAGTTGTCCTGATTCTGATAGAAAGATTTGTGACCGACATAAACGGGATGTACGTTGAATATTTAAG
ACGACCGGTAAGAATTCTCCACCGCGACATGCTTTTTTGGGCTGCTAACCCGAGAGTAGACGGACCTCATCAACAGGCAC
ATGTCCATTGGATTCACCGTACCGTTTACCATGATCATGAAGGATCCCGCTTGGACAGCGAAAGAGGTTGGACTGATCGT
GTCGGGATTCAGTAAGATAGAGAGCGAGGCACATCCTTCCACCAAGAACGAACGGGCGCTAATAGAACGCAGTAATCACG
GGCATACTCAATACGGCTGCGGTATGGGGTCTCTCTTACGGAGTGCAAAATTTCATTGTGAGAGTGGGAAGACGGCGACT
CGGTATTGAACGAGATACGCTAGTCGAAGCTACTAGCAGGCGCAGTCCGACACAAATTCGAGGGGGTCTCCAAGAACATG
GTGACAGCTATGTATCTACGTCGTCCACACTGACAGACAACCACTCGGTGCACTGTACGAGCGACGAAGAGGTAAGGGGA
ACCACGGCGACAAACAGCCAACAGCAGCAATTCCGGCCACTCACGCAAGCTGATCTCGGCTTTCCAGAGAGTGAAGAGCC
GGCCGGAAAATTGTGGCATTGCTGGGCAGGAATATGGCGGCTTGTTGCGAAAAATCCGGTTCCCGTCTTGAGTCTCGCTG
GCATCGCCATCATCGGATTTCCCACAGCCCGAGCCACTGGCAATGATGCGGCACTGGACACCTTTTTTCTCTTTTCCCTC
TGGACTGGAACCTTGGCAGCGCAGTCAACAGTCAAAAACACGACACATCTCCACCGACACCCACGGTGGCGAATAGTGCT
TGCCACGCTGCTCAATGCTGTCTTGTGGACCTCGCTTGGAACAATTGCCTACACGACTGCGAAAACAGCGGCGAAGCACG
TGACCATTGTGCAGGCTCTGAACAGTTTCCATACCGGGACAACGCTGGCGGACCTGATATACGCGGGCTCGCATAGTGAC
GCGACGATGGGAGCCGGAGATATTGCTACTTCTGTCCTAGATGCTGGCATCGTGATTTGGGGATTGAAGCTGTTTGAGTG
TCGGGCCCAGCTGTTTTCAAGGGCCGGCCTGACGGCACTCATGGTGGGCTCCGTGTTTGCAGTCATCAGCGTTGTCGGCG
GGCCGCTGCTGGTGCATGCTATGGGCCTGATACCGGCCAGCCGTGCGCTTGCATTTGCGGCGCGCAGTGTCACTATAGCG
CTGGCTGGACCGGCAATGACGAGCCTTGGCGGCGACTCTGGTCTCAATGCAGCGATGGTAGTAATTAATGGCATCGTGTT
CCAGGTGGCCATGGGCTTGGGAGCTTGCCAGTGGACGGTCCGGATGGTGAGTCACATCGCCCGGCGCCTCAGCTTAGTCA
GCCGAAGCGGCAGCAGAAGCTGCTGTGAAAGCAGAGAGATCAACGAGAACAGCGAGTCCAGCAGCTACATTCTACCTGGT
TTGACGGTGCAGACAGATTCAGCCCCGATGCCAGTATTGGCTCGTTGGGTATCCAACAGCGACCAGAATGTGACATTGGA
GGCCGAAAGAGCCGTTGTCGCATACGCTGTTGAGATGAAGGCAGGACTAGCAAAGGGAAGTGGGGGTGAATGCATGGTGT
CCATGCGTGGAGGTGAAGACATTTCAGATAACGAGACGGCGAGCAGTGACAGCCCTGGAACGGTAGCCGTGGGCATGATG
GTCGGTGTCAATGCCGCGGCCATGGGCACAGCGTACCTGTACGAAGAAGCATCTCGGGCAGCTCCGTATGCGGCATTGTC
CATGACCGTTTTTGGCGTTATGGTGGTGGTCTTCACAGCAATTAGGCCGCTGGCCGCCTGGTTGGCATCGCAGGTGACCT
AA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62