GenePrediction:GLEAN_558 Details

Name: GLEAN_558
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:591663..600705 (+ strand)
Length: 9043
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:591663..591944 (+ strand)
Length: 282
Type: CDS
Source: GLEAN
Position: GCSC_97:592016..592044 (+ strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_97:592129..592174 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_97:592242..592378 (+ strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_97:592436..592490 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_97:592542..592602 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_97:592676..595411 (+ strand)
Length: 2736
Type: CDS
Source: GLEAN
Position: GCSC_97:595483..596843 (+ strand)
Length: 1361
Type: CDS
Source: GLEAN
Position: GCSC_97:597118..598335 (+ strand)
Length: 1218
Type: CDS
Source: GLEAN
Position: GCSC_97:598486..599745 (+ strand)
Length: 1260
Type: CDS
Source: GLEAN
Position: GCSC_97:599875..600705 (+ strand)
Length: 831
>GLEAN_558 class=GenePrediction position=GCSC_97:591663..600705 (+ strand)
ATGATTGCGCGGGCTGCCATGGCTGCCTGTAGGCTGCACGACCACCTGTCGGACGGGGCAGCTTGGTCCAGTGACGAGAT
AGAGGAAGCATCGTTCATAGACCGTGGCGACAGCGTCGACCACAGCTACGACTACGGCTACGGCAACCGTCACAGGCTTA
AGCGAGACTACATCTACGATACGGAAGCTCCGGCGGAGGAGGCTGATGCCCTGGTTGCCGCGTCTCGGGCCTATCAGCTG
GAGATGTTCGAGGAGAGCCTGAAGAAGAACATTATCGTCGCTGTAGGTCGCATACCCTTCGTTTTGCTTCAATCGGGTTC
TAAATGTACAAACGGGCCTCTGACATTCTCCAGATGGACACCGGAACCGGCAAGACACGCGTGTAAGGCGCCTCACTCTT
TCTCTTTTCCTTCGTGTTGCTGCCTTGTTATGCCCAATCTGACGGTTTCTCTTTCGTAACTCCCAGAGCGATACTGCGGA
TCAGGACAGAGCTCGAGCGATCACCTCTAAAGGTCAGTAATCGGCATCGTCGCGTGTGAGCCTGAACAGCTATGCTGATG
GCCATTTTCATCTGAACAGATTGTGTGGTTCTTGGCCACGACTGTGTTTCTATGCGACCAGCAGTTCAAAGCGATCGTGT
CTCAGATACCAGGTGCCCAGGCAAAAATCATCACGGGACAGAGCGGCGTGGATGCCTGGTCGACACAGGCTGTCTGGTAC
GTTGCAAACGATCCTGATAGCAGACGGTTGTCGGCTGACAGCGGTGAACACAGGGACGCTGTACTTCTTAACGTCCGGAT
CGTGGTTGCCACGCATCAGGTCTTGTTGGTAAGCTTGAACGACGGTCGCATTGTTGTCTTTCTCCTAACCTGCCGTTAGG
ATGCCATGCACCATGGCTTTGTGAAGATATCGTCGATATCGCTGCTTGCCTTTGACGAAGGTGAGCTTTACACGGAAAGG
ATGTCTTTCATGAGACCACGATAGGTCCGGCTGACAGGCCTGTATACGCCAAGCGCATGCTTGCGTCAAGGAGCATGCGG
GCAAGAGGATTATGAGCGAGTTCTATTATCCTGCGCTGAACCGGGGCGAAGTGGTACCGGCGATCCTCGGCATGACGGCC
AGCCCGGTGCACGGCACGAAACTAGACGGGCTCGACAAGCTGGAGCAGACGCTGCACGCCGTGTGCAGGACGCCGAAGCG
ACATCGGGCGGAGCTGGTGGCACACACGAAACAACCGTCGACGTCAGCACACGTGTGCGACCCCCGCGCAGGCCTCTCTG
CACCGATCCCCCAGAACGCGGCGCGGCTGCAGCAAGTCTACGACGCGGGCGAGATACGGTCATTCACGGAAAACGTGCTT
GCGTACAAAGGTGGCGAAGGCGATGTTGAAGTGAATACAAAGGACTACGACCGGTCGTGGGCCTTTTTGAAGGCATTTTG
CCGTCGAACGTGCCACGTTTACGCCGAGCTGGGCTCTTGGTCGGCAGATTATTACGTGCACAAGGTCATCCGTCGCTGCG
TCAACGCATCGAATCGAAAAATTGGACCTGAAGGCCGCCGACCGTATCTGTTATTTCTACTGAAGCAGGTCAGATCTGTC
GCACCAGCAAAGCCAGTGTATGACGCCAACGCCGATTGCAGCAACAACATATCGTTCCTGTCGTGCCTGTCGGCAAAGGT
GTTGAAGCTGGTGGAGATCCTGGAGGCGTGCGAGGCGCGGCGACCGACGGGCATTGTTTTTGTCAAGGAGAGGCCGATGG
CTGCGGTGCTGGCACGGGTACTGTCGCTGCACCCTCGACTGCACGGTCGATTCCGGGCCGGTCATGTGGTGGGAATGTCC
CAGATGTACACGGACGTGTACGAGGCAGCGCTGGTGCTGAACCCGCGCAAAGGCAGCCAAGAGGCACTGCAGCTGTTTCG
GGGGGGGGCAGAAGCCGGGGAAGCAGGAAGAGGAAGGAGAGAAGGAAGCGGAATCAATCTGCTGGTGGCCACAAGCGTGA
TGGAGGAGGGCATCGACGTGCCGGCCTGTAACCTGGTGGTGTGCATCGACGAACTGACCAGCCTGAAGGCGTACATCCAG
AGGCGAGGGCGGGCACGCGAGGAGAACTCGCAGATGCATTTGCTGTTGGGGGAGGATCTGAGAGGGCGGCGGGCACTGAC
ACACGAATGGGAGGAGCTGGAGCACGAGATGAAGCGGCGGTACGAAGATGGCCTGCGCGAGCTGGCCGACCTGGACGGAC
AGCCCCGTGACGATGGCCTGGACGACGAGAACATAATGCCGCCGTTGGAGGTGGCATCCACACAGGCGAAGCTGGGGGCA
CGGGACGCCAAAAACCATCTGGATCACTTTTGCGCGACGTCGACGTCGGCCCGATTTGTCGACTGGCAGCCGGTATACAT
TCTGGAGGAATACGAAGGCGATGGCGAGTACGATGGCGACTTCAACGGCATATTTACGCGAGGCACGTTTGCGTCGCCTC
GGCTGCTGAGGGCGACGGTGCAGCTGCCGATCACACTGCCGGCCCATCTGCGGCGGGCGTGCAGCAAGTATGCATGGCGC
CAGGAGGAAGATGCATGTGCAGACGCGGCATTTCAGGCATACAAGGCCCTGTACGCGGCTGGGTTGATCGGTGACAACCT
GCTGCCACCCAAGGCGACCGAAGATGACGGGCTTGCCGGTCGGACAATTGAGGGTCGACCGGGCGTGGTGACGGTACATG
CTCGTCAGCGGCCCTGGACGAAGTTGGCGCAGGCCTGGACGGCGTTGGACGCGGCCGCGGATGGGCCTGAGCGCTGGCTG
TACCGCCATGCAATGCGGCTGGTCGATAGCGACGGTGTTGAACTGTATCATGCTGACATGCTGCTGCCAGGCGGGTTTAG
TGGGATTGGGGCAGCAGAACCGATGGACATTGCGCCGGTGCGCATGTTCTGGTCGCCGCAGTCGACCCGGCCGTGGACAA
TGGAGTTTGGGCCAGGACAGCGCGAGCTGGTCCAGAGAGGTGGTGGTGATGGTGGTGGGAAAGGCGACGATGACCAGACG
GCTGTGCTTCTCAATGCTGCTTACGGCCACCGCTGGCCCATCAAGGAGGAGCACCGACTCGTGCGGATTGAGCGAGTGGA
CGAGCCGCGGCCGACAACCGAGCAGGTGGGCGCAACCGAGTTTTCCGAAGCGCTGTCTGCAGGCCAGCTGTCAGCCTCGT
CGTCTGACCCGCGCACGTCGTATCTTGTCCGCGGCCCCGATGGCTCGCCGTACCTCTACCAGGGCTATTCGGCGACCAAG
CCGGCGGCGGACAAGATCCGACGACCGTACAAGGGCTTCGACGAGGATGCAGACGATGTGCCGTACGTGCTCTTGCGACC
GCTGCCGAAACAGGTTGGTTCCCTACACCGAGTCGTCAACTGCGAGAGAGATGGAGAGGGCGAGGAACAAGGAGGGTCCA
AAGGAGAGTCCAAGCGGCCGTTCTACACCGTCCTTCCAGCGGCCAGTTGCCGCGTGGACCGGATGCCCATGGCGGCGGTG
CAGTTCGGCGCGCTGATCCCGCCGTTGATGCAGGTGCTCGAGGTGCATCTGGTGGCGGCTGAGCTGCTGTCTTCGACGCG
GCTGCGCGAGTTGCCGGTAAGCGATCGCTCGCTGATCACTACGGCCATCAGCGCGCCGGCGGCACGGCTGCACGACAATT
ACGAGGTGCTCGAGTTCATCGGGGACGCCGTCCTCAAGCTCATGGCAGCGGCTAACTGTGCGGCCCAGAGTAAGTGTGAT
GGTGGCGGTTGTGGTTGTAGCTGTTCTGGTTGTCATACGCTGACTAATCACGTTAAATAGACCTCGACGCGCCCGAAGGC
CACCTATCTCTGTTTAAGGACCGGCTGGTGGCTAACTCGCGGCTCTGTCGAGCAGCAACAGAGTTTGGGCTTGATCGATT
CATCGTGGGATCGCAATGGTCGCTGCGCGAGTGGCGGGACGTCAAGATCGAGGCGGAAGAAGAGAAAGGCGGAGAGCAGC
TGGTGATGTCGACCAAGACGCTGGCCGACGTGGTGGAGGCACTGATCGGAGCGGCACTGGTGGACGGTGGCCTGACTCGA
GCGCTGGAGTGCATGCGGATACTTTTACCGGAGCGGCAGCCATGGCTATCGCTGGAGAAGACACGGGCGACATTGTTTGC
GGCGGCACCGAAACAGACGACATGGCGGATACCGACAACACTGGAGGAGCTATTGGGCTATCAATTTCGACGACCGTCGC
TGCTGGCCGAGGCGATGACACACCCATCGACGCCGGGAATACGGGAGGGCGGCTGCATGGAGCGGCTGGAATTTATCGGC
GACGCGGTGCTGGACTACGTGATCGTGCAGCGGCTGCTAGGAGGCAAAGGGGGCAAGCGGCTGGACCTGGAGCACCAGAA
GATGCACCTGCTGCGGACGACGGTGGTGAATGCGGCTTTTCTGGGCTTTGCGGCGATGGAGTTCAGCATCAGCTCGGAGG
CTTCGACTGTGACGGCGGATGGCACGGTGACACGGGGCGAGATCGCGACGCCGCTGTGGGCGTTTATGCGGCACGGCGGA
TCGGATGAAATGGCGCGAATGCAAAAGGCAGCGCAGAAGCGCCACGCAGCACTGCGCGAGTCCGTGCTGGCGGCGCTGTG
GGAGGGCTCAGAGTATCCGTGGGTGCAGCTGGCGCAGCTGCGGCTCGAAAAGGGCTTCTCGGACATTGTGGAGGCGGTGA
TCGGGGCGGTGTGGGTGGATGCTGGCTCGCTGGGGCCGGTGGAGGCGCTTCTGGAGAAGATGGGGGTGCTGTCGTACCTG
CAACGAGCGCTGGACGAAGACGTGCATCTGCGGCACCCCAAGGAAGAGCTGGGCCGGATCAGCGGCAATGCGCGGCTGCA
CTACCGGGTGGCGGCAGGCGAGTCAGTACTTCCTCCGCTGGCCGAGGTGCGGCGGAAGCGCAGACGCGACGAAGAGGCGG
CCCAGGATGAGAGCAGCGACGAGGACGAAGACGAGGAGGGGGACGAGAAGAGGGAGGGGAAAGAAGAGGGGGCCCGGGCA
GACCAGGCACCCATCTTCACGTGCCGGCTGTCGATCAACGGTGTCTGTGTGGTGGAGATCCTGGACGGCCGGTCGCGCGA
AGAGGCTGAGGTGCGAGCAGCGGCGATTGCGGTGCGTGATCTGAAGGAGGGGAAGATCAAGGTACGAAGCGATGAAGTCG
AGTAAGAGGAGTCGGATAGTAAGATACGTATATATGCGTATAGCAATATACAAATGTCGGATAGTAAGATACCGGACGAT
TGAGCACGTGCCAAGGTGGCCTGAGGCAGTCCCGATAATGGACTATTATGTAATTTCCCCCTAGAGGCGTGCAGGAGCTG
CTTTGCTGCAACAGCCTGTGCCCGCGAAGCCGTGTCGAGGACAGAGAGACGGGACCGGCACGACAGGATTCGGCTTGCGA
TTGCGCCCACGACAGGAATCTCTGCGCGGCACCGACGTTTGCCAACGATGCCCACGGCCGGCCGATGAGCGCCAGAGCCG
CAGCTGCGAAGCGAGCTGTTACGGAAGCGAGCTTGGAAGCGGAGAAGAACGTCGAGAGTTGAGAATCGAGAGGCGAAAGA
GGCGAGAGAGAGAGGAGAGTCGGAAGCCGACGACAGGACAGGAGGCCGTCACGATGCCTGCGGACGGACAGCCGGTGGCG
GGCGGCGGCAACATTCGCGTATTTGTGCGCTGGCACGAGCCGACTGTCTTCTCGGGTGAAGAGGTGCGATGCCGCATCAC
CTTTCGCAACGTGGCCCCGAAGCCGGCGACGATGATGGCGACGGCGACAGCGACGACGACAACGACGAGACCGACGACGC
CCGCGCTCGTCCGTCACGCGTCGATCTCGTCGGTCTCGTCGATCTCGTCGATCTCGCACCACCACCACCTGCACCAACAA
CAACACCATCACCATCACCATCACAACTCGTCCCACGGCAGCTACCAGTCGCTGCCGCTGCCGGCGACATCTGCGTCTGC
GTCTGCGGCAGCATCGACGTCGCTGCTCGCGGCCCCGGTCCTGTTAGCCGGACCGAGTCCGAACAACATGAGCAGCACTG
CCCGCGGTCACCAGCGGGGGAGCCTTTCCCTGAGCGGCCCGGCCATCACATCGCCGCGGACGGTGACGCACGTCCGGCCC
AACACCGGCACCGGCACCACCAGCAGCACTAGCAGCAGCAGCACCCCCGGCCGTGGCCACGCCGGCCGCGACCATCGGCG
GTCGCTCTCGATCGTGTCGCTGCCGTCTCCTGGCGGCCCCAACAGCGCGCTGATGGCGTCGCCTACCGGCAGCCTTGCCG
GCGGTGCGTCTCCGCTCCTCGTCGGCACAGCCGGCTCGTCTACGCCGGCAGCACAGCGACCACGCACGCGCGGTCACGGC
CGGGCGGCCAGCCTACAGATCGGACCGCGGACATCGATGACCAGCAGTGGTGCCGTCGCGAGCGGACAGAACGGACAGAA
CGGCAGCAGCACCATGACCAGCAGTCCCGGAGGACCGCGGTCGGCCGCCATCGCTCGGTCCTTCTCGTCCCAGCCGTCGC
CGCTGTACAACGCGTCGTTTCCACCAACGTCGGGACGCATGCTTCCTGGAGGTCACGTGCCATCCACGTCCACCGCAACA
TCGACGGGCCCCAACACGCCCGACATGGGCGTCGTCTCGCGGGCGTCGCCACGCTCCGGCCACGACGGCTTCCCCGACTG
GAAGTTCCCGGCTGCCGCCGCAGCAGCGGCAGCGGCTGCAGCGGCCATTGGCGGCGGCGGTGGTGGTACGGCCTACTCGC
CGTCACCGCCGCCGCTGGAAAAGGCGCTGCCGACCATCTACAAAGGACCGGTGCCGCCGCAACAACAGCAGCAGCAGCTG
CTGCACGAGGCGGCCCGGGTGCTGTCGACGACCAGCATCGCCGGGACGCCACGCAGCAGCGGCGAGTTCTACTCGGTCAG
CAACCACTCGAGCGAGACGCTGGCCTCGGAGTACGTGGGCCAGCTGGCCGGGCAGCCGGCCGCCCTCTTGCGGCTACAGC
AGCAGCAACAACAACAACAACAACAACAACAACAACAGGCCCTGCACGGAGCAAGTCCGCGGCCGCCACACATGCGGCAA
AAGTCGAGCTCGAACCTGCTGTATCCGCCGTTGCAGGCACACCGGTCGCGGGCGTCGTCGTCGGCAGCAGCCGCGGCAGC
AGCGACGAAGCCGGAGACGCTGATGATGGGCTATGCACAGATCCAGGGGTCCTTCACCCTGGACGGCTCGCTCGTCGACC
TGGGGCCGTTTGAGCTGGTGAAGCGCAAGGCCGTGGTGGGCGGACAGGGTGGCGGGGTGATCGGGATAGAGATGGGCGGC
GGCAGCAACAACAGCAACAGAAACAACAGCAGCAGCAGCAACAGCAGCAACAACAGCAGCAGCAGCAGCCGGCGCGAGGC
CGGGCTGCTCCGGGGGTTCGGTGGGTTCGGCGGGTTTGGCGGCAAGCTGAGCAGCAGCAGCGGCTGGAGCAGTCTCACCA
GCTCGCTGGGCGAGCTGCTAGGCGGTGGTGAGATGAGCACGATCCGGGAGATGCGCGACCTGGCGAGCGCCAAGGCGGTG
CCGCTGCTGTCGACGCCGCAGTCGGTCCTGTTTGTCGATCTGCAGCTGGCGCCGGGCGAGAGCGAGACGTTTGAGTACGC
CTTCCGGCTGCCACGAGGCCTGCCGCCCACCCATCGCGGCAAGCTGATGAAGATCGCCTACGGACTCGTCATCGGCACCC
AGCGGCCGGGCTCGGCGCGCGAGCAGCGCGTACGCTCCGTCGAAGTGCCCTTTCGCGTTCTTGGCAGCGTCAACAGCCAC
GGCCAAATCCTCGGCCACGACCTAACCACGCCGTACATTCTGCTGCGAGACCAGGCCGTCGTGCGGCCGGTCGAGGGCGA
CGACGGCCGGCAGCAGACCAAGCAGACGAAACAGACCAAGCAGGCCAAGCAGGCCAAGCAGGCCGAGCAGACGACGCAGA
GCCGGGAGGCCGAGGCGGCGCACAAGACCAGTTTTCTGGCTTACGTGGACGAATTGCTGAGTCAGCAACAAGAGAACAAC
AGCGTGTCAGAGCAGATGAGCAGCAGCAACAACAGCAGCAGCGACAGCACGACGACGGCCTCGACGGCGAACCGGCGGGG
GGGGCTGATGTCGCCGACGGTGGGGCCGGCCTCGCGACGGCCGTCCTTTCAGTCGGACGATGGGAGTGGTGGTCCGACGT
CGCTGTCGGCGCGAGAGGCGATTGACCTGGCGATTCTACGCAGCAACATGGCCGACCGAGGCAGCCGGAGCGACAACAGC
CGCGAAAAGGCAGCGGTGAGCGCGAACCGGTTTGAGATTGCGCGCAACGGGCGGCGGGTGGGCACGGTGCTGCTGGCACG
GCCGGCATACCGGCTGGGCGAGGCGGTGACGTTGGCGGTGGACTTTGCCGGGGCAGCGACGCCCTGCTATGCGGTGCATG
CGAGCCTGGAGACGGCCGAGCGGATCGTGGACCCGTCGCTGGCGCTGCGCTCCGAGGCGAGCGTGCAGCGGGCGACGCGG
CGGGTGTACGCGTCGGCGTCGGAGGCGACGCTATGCGCGCGGCGGTTCGTCTTTGCGCCGACGATTCCGGCCTCGGCAAC
GCCCGAGTTTGTGACGAGTGGCGTGAGCCTGGACTGGAAGATCCGGCTCGAGTTTGTCGTGCCGGCCGGAGAGGAGGAGG
CAGAGGCGGACACAGCCGGCGAAGGAGAGGGGGACGAAGACGAGCGAGAGGACATGGCGGCCGGAGTCCACGACGATCCA
GACCGTGCACACGAAAGCCAAAGCCAAAAGACACAGACGGCGCGGACCCGACGACGCCGACAGCTGCCGCCGCTGCTCGA
GGAGGTCGGCCGGGACGATCGCGGAGGCCTCGTGCTGGTGGCGGCCGAGACGCTGGCGTGCGAGAGCTTTGAGGCGGCCG
TGCCGCTGCGGGTGTACGGATGGCCGAGCGGAGGCGGGCCCATCGACGGCGAGGAGGCCGACATGCCCGGCATGGTTGTC
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62