GenePrediction:GLEAN_5591 Details

Name: GLEAN_5591
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2182241..2179908 (- strand)
Length: 2334
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2182241..2182137 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_173:2182055..2179908 (- strand)
Length: 2148
>GLEAN_5591 class=GenePrediction position=GCSC_173:2182241..2179908 (- strand)
ATGCCTCCTGCGAAATCGCGGTCGCTGCCGACCAAAAAACATGCATTGACACTTGCCCAACTGGCATCGTACGATGACAT
CTTAACCGACGCGCTCGTCGACCATGTAGGTTAATGGCGCAAGACCCGCGCAGGACTCTTCCTAACAACCGAATTCCCCT
ACTGGACATCTGACATGCCCTTCCAGGCTTACTACTGGACATCAATTCCAAAAAACCGTCCCTCCTATCTCCCTTCTCGC
GGAGTGAAGGAGGATGAGATTACAAAGATCATACAGACACATCTTGCCGTTAACCCGGACATCCAAATTGCAGAAGAGAA
GCTTCTGGCTACAACTGGACTGGCCAAGTTTTACCGGGCCTTGAAAACGGACAGAGAAAAACAGGACTTTCGATGCCATA
TGCGCAGGTATATGCAAATTTACTTGCCCGACTGCCCCTACGAAGTAGCATCAACAAACCGGTATACCATTTTCCAGCAG
GAGGCCAGTATATCCGCCCGCCGGTTCATCAAATCGCACGAAACCATCAAATACCTATCGGGTATTCAGGTTGTTATCAC
GCCAGAGGAGGAGGCCCAGCTTTCCGAACGCAAGAAAGATTTCAGCATCGTCATTAGCTCCCGAAAGAAGGAGGTGAACC
TATTCATGGGCCCAGCTCGTTTTGCGAATCACGATTGCGATGCGAATGCGCGGCTTGTAACAACTGGTCAGTCTGGCATC
GAGATCATCGCGACCAAGCCAATTGGTGTCGGCGATGAGATAACGGTCACCTACGGAGAGAACTATTTTGGTGAGGACAA
CTGCGAATGCCTGTGCAAGACATGCGAGGGCAGGCTGGTCAACGGCTGGGCACCGGGCGAGGGCACTGCACCTGTCAAGC
GAAGCATCGAAGTTGGTGCTTCCACACCAACTCGTGGCTACTCCTTCCGGAGGAGAGATGAAAACCCCGCTAACCGCGGC
CGTTCCGAAACGCCTTCTCTTACCCCCATTGCGCGACCGAAAGTTCGCAGGACAAAGCTTCGGATTTCAGAGCGTGCAGC
AGAGTCGACACCTGCATCCGACAGCGAGCATACCGGTAAAGAGGCTGCTGTCGCCAGCCGTCGCCGTGGACACAAGAGGG
ACGCAAACAGCTTGGCCACACCCCCTATCACCCCAGCCAAGCGGCAAAATATTGCTCGGACAGATGCCGGAATGGCCTGT
CCAGCTGCACTCAGTACGAGTTCAAGGGAAGGATCGACTACCGACAACAACGACGATGGCTCCGGTGCTAAATATCTTCC
GACACGTTCTGCTCCGACACGTTCTGCGGATTTCGGTTCTATTGCGCAGAGCATTGAAGTCGCCCAAGACGGTGTAAATA
GCCTTTGTGCACATGACCGCATCCCAACGTCTGACCCACCAGCGCAGCTGCTGGGTTGTAGGTCCAAAGCATGTGTTCCA
ATATCAGCCAGGGTTTTGTCTCCCTCGGTTGCCGGAACCGATGAAGTTGCGATTGTCGAGGAGGATGACGCTATGCTTCA
GACAATCGTGGTGGCATCGATAAACACCCTTTCCCTTCCCCCGCCAGAATCGACTGTGGACAGTAGCGAGGATGATCGCC
TATCAGCCAGTGCTCCAGACGAGACAACTGCGGACAGCGTTTCAAGTCCTTCAACTGTTAACGAAGAAGAAAGTACGGGA
TACGACAAAGAAGCCGCCTCGGCCTCGGTGGATGCAGAGGACGAGGCCGGTGCACTAACCCAGCCAAGCCGCCGTGTACC
TGGAGATTACACTTTGACTCCACTCCTATTATCGGAACCAGAGACTGCGTGGGTGTTCTGCACAGTCTGCTCAAAAGCCT
TTGTACAACGGGATGCATATTACACACGTATGTCCTGCCCAAGATGTGAACGTCACTCTAAACTTTACGGATACTTGTGG
CCAAAGACAGAGCCAGAGGGGAAGTGGGATAAAGAGGAACGCATCCTGGACCACCGATTGGTACACCGCTTTCTCGACGC
GAACGATGAAGCCAAGGCTCGCGGGAGGAAACGGCCGATTTGGCAAGCGGAGCCTGCAGAAGACGCGGAACCCAGCCGCA
GAAAGCGGTCATCTAGCACACAGGCAGAAGGCCTTGGATCGGGAATCTGGCGGAAGTTGAAGTACATGATGCCCAAGGAG
GAAACTCCAAGCAGAGTGTCCAAACGAGGGACCGGGGCCGGATCGGCGAGAGGATTGAAGATGGTCCAGTCTGTCGGAGT
GGCTACAAAGAAAGCAGACGCTAGTGATGCTGTTGATGGAATGCGCTGTAGTCGGCGTTTTCGCAAGGCCGGCAGTACAG
TGTCAGACATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62