GenePrediction:GLEAN_5592 Details

Name: GLEAN_5592
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2179288..2177447 (- strand)
Length: 1842
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2179288..2178478 (- strand)
Length: 811
Type: CDS
Source: GLEAN
Position: GCSC_173:2178414..2177447 (- strand)
Length: 968
>GLEAN_5592 class=GenePrediction position=GCSC_173:2179288..2177447 (- strand)
ATGGCCAAGATTACATCAACGAAGCTACCTATCCACTACGGCTTGCCGCCGTCGAAGCAAGCAAATGAACCGCCACAAGC
CAGGTCGACGGCTTCGTCGGGCATCAGCTGCCACGATGAAGTAGCCTCGGAGCAGGGCAGCGATGCTTCTCAACCAAGTC
AGGCCTTGCGATCGATCGAGTCGCAGTGCTTCGCTATCACGGACATGTCGCAGCGACCGGCGGCTAAGAACACAATATGT
GCGGATTGTGCTTACCGTATGAGTCTGGACGAGGTGAAGCAGTGCCGTGTATTCTTCGGTGGTGAAAAGGCGGTGATGGA
CAGCCAAGAGTGCGTGATTTGCAGTTGGAAGACAGGGAATCCGGCGGCGTTCACATGGCCGTACCTGAACTTCATGACGG
AGAATCCGACCATCTTCCATGCGGTGGACTACTTTAAGCAGATTCTCAGAGTGGCAGGCTTCGAGGAGCTGACCGCGCGG
GAGGACTGGTCGGCCAGGCTGAGGCCCGGTGGAAAATACTATGTGACCCGCAACGGAAGCACGCTGGCGGCATTCACGAT
CGGTGGCGCCTACAGGCCGGGCAACGGAGTGGCGATCGTGGCCGGCCACATCGACGCGCTGACGGCCAAGCTGAAGCCTG
TCAGCAACAAGCCAGACAGGGCGGGCTATGTACAGCTGGGTGTGGCGCCGTATGCAGGCGCGCTCAACGAGACCTGGTGG
GATCGGGACCTGGGCATCGGCGGCCGGGTAGTTGTGCGCGATCCAGAGACAGGCTGGACAACCACGCGGCTTGTCAAGCT
GGACTGGCCAAGTAAGTTCCAGCCGTGGGTGTGCTTGAGTGGGTGAGAGATGCAGGTGCTGACGGTCGGTGCAGTTGCCA
AGATTCCTACACTGGCGCCACACTTTGGCGTGTCGATGACGGGCCAGGGCAACAAGGAGACGCAGCTAGTACCGGTGATC
GGACTGGACAGCGGCAGCAAGACGGGGTCGATGGCGGAACAGGCCAGGACCGTCGAGCCGGCGCTGGGCCCGGCTGGCTC
GTTTATCGCCTCACAGCCGCCCAAGCTGGTGAAGCTGATCGCGGCCGAGCTGGGTGTCAAGTCGTACGCGTCGATTGTCA
ACTGGGAGCTGGAGCTATTCGACACGCAGCCAGCGACGGTGTTCGGCCTGGACAAGGAGATGATCTCGGCTGGGCGGATT
GACGACAAGATCTGTTCGTGGGCGGCCTTGGTGGCCCTGTTGCGTGCCCGGGACAACGACTCGTCGGGGGTGGTCCGGCT
TGTCGCCCTCTTTGACGACGAGGAGATTGGCAGCCTGTTGCGACAGGGGGCCAAGAGCAACTTCCTGCCGCTAACGGTTG
AGCGGATTGTGGAGGCCCTGTCGCCGCCGATAGTGGGCAGCTTCGGTCCGGGCGTGATTGGGCGCACATATGCATCCAGC
TTCCTAATCTCGTCGGACGTGACGCACGCGATACATCCCAACTTTGTGGCCAACTACCTGGACGACCACGCACCCAAGCT
CAACGTCGGCGTGGCCATCACGCACGACAGCAACGGCCACATGACGACGGACAGCGTCTCGACAGCGCAGCTGCAGCGCG
TGGCCGAGCTCAGCGGCTCGACCCTGCAGCGGTTCATGATCCGCAACGACTCGCGCAGTGGTGGCACCATCGGCCCCAGC
CTCAGCTCGGCCATGGGTGTCAAGAGTGCCGACGCAGGCATCCCGCAGCTGAGCATGCACAGCATCCGTGCCTCGACCGG
AGCACTGGACCCAGGTCTAGGCGTCCGCTTTTTCCAGGGGTTTCTGGAGAACTGGGAAACTGTTGACGCAGAGTGGCAGT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62