GenePrediction:GLEAN_5593 Details

Name: GLEAN_5593
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2174466..2172825 (- strand)
Length: 1642
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2174466..2174125 (- strand)
Length: 342
Type: CDS
Source: GLEAN
Position: GCSC_173:2174065..2174018 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_173:2173895..2172825 (- strand)
Length: 1071
>GLEAN_5593 class=GenePrediction position=GCSC_173:2174466..2172825 (- strand)
ATGGAGAGCTTCCGTGGCATACCTTTTGCTCAGCCACCCATCGGCAACCTGCGGCTGCGTCCGCCCCGTCGCCTTGTCCA
AAATATCGGCAAGCTAGATGCAACGATTCTAGGATCCAGCTGTCCGCAGCTGATCCTGTCTTCTGGAAGCAACAGCATAG
CCACGAAGTATCTTGGCAAACTCGCCAACAATCAAATGTTCCAGAAAGCTGCCAACGTCAAGGAGGATTGTCTGACCCTC
AATATCCAGCGACCTGCTGGTACAAGTAGCAGCTCCAAATTACCGGTGATTTACTGGTTCTTTGGGGGTGCTTTTGAGGT
GCCGCCCTCAGACTCTCTCAAGGTGACTGTCACTTATTTTGGAGTATAGCTAACATTACTTTGCAAACCCCCTTTCTTTA
GTTCGGCACAAACAACGTCTACGACGCTACAGGCATCATCAATCTCAGTGTACGCTTAGGAGAGCCTGTCATGTATGTTA
GTGCGAACTACCGTGTAGGTGGTTTTGGCTTCCTTGCCGGAAAGGAGGCGCTTGCCCCCAGGGCGTTACCAATCTTGGCC
TTCTGGATCAGCGTCTCGGCCTGGAGTGGGTTGCCGACAACATCCAAGCCTTTGGTGGAGACCCGAGCCGTGTCACTCTT
TGGGGCGAATCATCCGGGTCCGTGTCTGTCTTTGACCAGATGCTGCTCTACGAAGGAAACAACACATACAAGGGGAAACC
GCTATTCCGCGGAGCAATTATGGACTCGGGCAGTCTTGTACCTGCGCAGCCCGTAGACTCGCCCAAAGCCCAGGCTATCT
ACGATTCTGTTGTTTCTGCTAGCGGCTGTGAGGATTCCGACAACACGCTGGACTGCCTGCGCAACTTGCCATACGACCAG
TTTCTAAACGCCGCAAATGCTGTCACGGGCATCTTTACCTACAGCTCACTAGCACTATCGTATTTGCCACGACCAGATGG
CATAACCTTGACACAGAGTCCCGAGGTCCTGGTACGCAACAACTCGTATGCAGCAATTCCTATGATTATTGGGGACCAGG
AGGACGAGGGTACCGTCTTCTCTCTCATGCAGACAAATTTGACATCTACCGCAGCGGTTGCTCAATACCTCAAGGATTTC
TATTTCGAAGAAGCTACTCTGGAGAAGTTGATACAGTTTGTTGACACCTATCCGGACGATCCGACCGTTGGCTCACCGTT
CCGCACCGGCAATGCCAACGAGCTATACCCGGGCTTCAAGCGCCTGTCTGCCATTCTGGGTGATATTGTGTTTACACTGG
CACGCCGCATGTTTCTGGCCAATGCAAAGACCACGAACCCAAATGTGCCTGCGTGGTCATATCTGAGCTCCTACAATCAC
GGCTTGCCATTTCTAGGCACTTTCCACTCGTCCGACATCGTCCAGGTTTTCTACGGTATCCCGTCAAACTTTGCTGGTCG
CGCCATTCAAACTTACTACATCAATTTCATCAACAGCCAAAATCCCAATGTTGGCACCGATGTATACATGAACTGGCCAA
AGTGGGGAGATGATCTTCAGCTTGTAAATTTCTTCTGTCGTCATGCGAGCTTATTGAAAGACGATTTTCGCCAAGAAAGC
TACGAATTTATCGCCCGGAACGTCGCTTCTCTTCATTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62